Incidental Mutation 'R1699:Evpl'
ID192547
Institutional Source Beutler Lab
Gene Symbol Evpl
Ensembl Gene ENSMUSG00000034282
Gene Nameenvoplakin
Synonyms210kDa protein
MMRRC Submission 039732-MU
Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1699 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116220559-116238077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116227588 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 731 (Y731C)
Ref Sequence ENSEMBL: ENSMUSP00000037850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037007]
Predicted Effect probably damaging
Transcript: ENSMUST00000037007
AA Change: Y731C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: Y731C

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Blast:SPEC 44 140 1e-16 BLAST
Blast:SPEC 140 226 4e-46 BLAST
SPEC 229 330 2.21e-6 SMART
Blast:SPEC 336 500 7e-68 BLAST
low complexity region 508 525 N/A INTRINSIC
Blast:SPEC 527 632 4e-41 BLAST
Blast:SPEC 635 746 5e-48 BLAST
Blast:SPEC 753 867 7e-49 BLAST
low complexity region 868 881 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 1011 1030 6.54e-6 PROSPERO
internal_repeat_3 1012 1032 1.94e-5 PROSPERO
coiled coil region 1035 1077 N/A INTRINSIC
low complexity region 1131 1144 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
PLEC 1186 1227 1.48e2 SMART
low complexity region 1228 1242 N/A INTRINSIC
coiled coil region 1262 1366 N/A INTRINSIC
low complexity region 1398 1414 N/A INTRINSIC
internal_repeat_2 1457 1476 6.54e-6 PROSPERO
internal_repeat_3 1516 1536 1.94e-5 PROSPERO
low complexity region 1595 1617 N/A INTRINSIC
PLEC 1679 1714 9.19e-4 SMART
PLEC 1729 1764 4.53e1 SMART
low complexity region 1788 1800 N/A INTRINSIC
PLEC 1819 1856 1.41e-4 SMART
PLEC 1857 1894 5.4e-10 SMART
PLEC 1895 1932 2.7e-10 SMART
PLEC 1933 1970 1.21e-3 SMART
PLEC 1971 2008 1.16e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Evpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Evpl APN 11 116234505 missense probably benign 0.01
IGL00896:Evpl APN 11 116222584 nonsense probably null
IGL00941:Evpl APN 11 116227901 missense probably benign 0.06
IGL01443:Evpl APN 11 116222454 missense probably damaging 1.00
IGL01523:Evpl APN 11 116233444 missense probably damaging 1.00
IGL01957:Evpl APN 11 116223222 missense probably damaging 1.00
IGL02124:Evpl APN 11 116227015 missense probably benign 0.01
IGL02334:Evpl APN 11 116231024 nonsense probably null
IGL02457:Evpl APN 11 116230113 missense possibly damaging 0.87
IGL02502:Evpl APN 11 116222718 missense probably damaging 1.00
IGL02536:Evpl APN 11 116221209 missense probably damaging 1.00
IGL02948:Evpl APN 11 116221822 missense probably damaging 1.00
IGL03183:Evpl APN 11 116221612 missense probably damaging 0.98
IGL03405:Evpl APN 11 116227927 missense possibly damaging 0.89
A4554:Evpl UTSW 11 116220834 missense probably damaging 1.00
R0082:Evpl UTSW 11 116235003 missense probably damaging 1.00
R0108:Evpl UTSW 11 116220876 missense probably damaging 1.00
R0514:Evpl UTSW 11 116223291 missense probably damaging 0.99
R0581:Evpl UTSW 11 116229490 missense probably benign 0.02
R0727:Evpl UTSW 11 116232485 missense probably damaging 1.00
R0791:Evpl UTSW 11 116227723 missense probably damaging 1.00
R0792:Evpl UTSW 11 116227723 missense probably damaging 1.00
R1079:Evpl UTSW 11 116230068 missense possibly damaging 0.48
R1514:Evpl UTSW 11 116223835 missense probably benign
R1717:Evpl UTSW 11 116225492 missense probably benign 0.06
R1775:Evpl UTSW 11 116223660 missense possibly damaging 0.66
R1886:Evpl UTSW 11 116227576 missense probably damaging 0.97
R1903:Evpl UTSW 11 116227028 missense probably damaging 1.00
R2081:Evpl UTSW 11 116234266 missense probably damaging 1.00
R2137:Evpl UTSW 11 116221839 missense probably damaging 0.99
R2571:Evpl UTSW 11 116237969 missense unknown
R3081:Evpl UTSW 11 116220852 missense probably damaging 1.00
R4097:Evpl UTSW 11 116223177 missense possibly damaging 0.89
R4541:Evpl UTSW 11 116232644 missense probably benign 0.01
R4562:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R4703:Evpl UTSW 11 116222505 missense probably damaging 0.98
R4947:Evpl UTSW 11 116223375 missense possibly damaging 0.88
R5243:Evpl UTSW 11 116222969 missense probably damaging 1.00
R5325:Evpl UTSW 11 116221365 missense probably damaging 1.00
R5416:Evpl UTSW 11 116234259 missense probably benign 0.13
R5580:Evpl UTSW 11 116234232 missense probably benign 0.14
R5873:Evpl UTSW 11 116234432 missense probably damaging 1.00
R6298:Evpl UTSW 11 116230922 missense probably damaging 1.00
R6438:Evpl UTSW 11 116230101 missense probably benign 0.00
R6742:Evpl UTSW 11 116222814 missense possibly damaging 0.80
R6753:Evpl UTSW 11 116237906 missense possibly damaging 0.95
R6764:Evpl UTSW 11 116222944 missense probably damaging 0.99
R6846:Evpl UTSW 11 116223807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCCATACAGGTGTGAGAAGC -3'
(R):5'- AAGAACTCCTTCAGCAGCAGGC -3'

Sequencing Primer
(F):5'- aaatcttcctgcctctgcc -3'
(R):5'- CCTGTGTGCTGGGGCTG -3'
Posted On2014-05-14