Incidental Mutation 'R1760:Ctnnal1'
ID192679
Institutional Source Beutler Lab
Gene Symbol Ctnnal1
Ensembl Gene ENSMUSG00000038816
Gene Namecatenin (cadherin associated protein), alpha-like 1
SynonymsCatnal1, ACRP
MMRRC Submission 039792-MU
Accession Numbers

Genbank: NM_018761.3; Ensembl: ENSMUST00000045142, ENSMUST00000107612

Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R1760 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56810935-56865188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56838988 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 235 (M235K)
Ref Sequence ENSEMBL: ENSMUSP00000036487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045142] [ENSMUST00000107612]
Predicted Effect probably damaging
Transcript: ENSMUST00000045142
AA Change: M235K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036487
Gene: ENSMUSG00000038816
AA Change: M235K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Vinculin 30 309 7e-39 PFAM
Pfam:Vinculin 302 526 1.7e-12 PFAM
Pfam:Vinculin 531 683 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107612
SMART Domains Protein: ENSMUSP00000103237
Gene: ENSMUSG00000038816

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Vinculin 30 214 5.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154511
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and fertile and exhibit no overt phenotypes or defects in hematopoiesis and hematopoietic stem cell function. [provided by MGI curators]
Allele List at MGI

All alleles(111) : Targeted, other(2) Gene trapped(109)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh23 G A 10: 60,326,076 T1997M probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Kpna3 T C 14: 61,370,541 E405G probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Nek9 T G 12: 85,305,590 D833A possibly damaging Het
Nek9 T C 12: 85,310,410 E660G probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rab3ip C T 10: 116,937,510 D133N probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc38a11 C T 2: 65,355,319 probably null Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Tmem94 A T 11: 115,796,754 K1146N probably damaging Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vegfa A G 17: 46,025,469 Y242H probably damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Ctnnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Ctnnal1 APN 4 56829544 missense possibly damaging 0.90
IGL01404:Ctnnal1 APN 4 56829590 missense probably damaging 1.00
IGL01523:Ctnnal1 APN 4 56835243 missense probably damaging 1.00
IGL02413:Ctnnal1 APN 4 56835306 missense probably benign 0.19
IGL02618:Ctnnal1 APN 4 56817060 missense probably benign 0.07
IGL03109:Ctnnal1 APN 4 56839045 missense probably damaging 1.00
IGL03159:Ctnnal1 APN 4 56844599 missense probably benign 0.00
IGL03208:Ctnnal1 APN 4 56813833 missense probably benign 0.00
IGL03250:Ctnnal1 APN 4 56812356 missense probably benign 0.00
NA:Ctnnal1 UTSW 4 56817044 missense probably benign 0.02
R0217:Ctnnal1 UTSW 4 56813230 missense probably benign 0.43
R0391:Ctnnal1 UTSW 4 56847921 missense probably damaging 1.00
R0513:Ctnnal1 UTSW 4 56835348 missense probably benign 0.01
R0582:Ctnnal1 UTSW 4 56813228 missense probably damaging 1.00
R1434:Ctnnal1 UTSW 4 56847971 missense probably damaging 0.96
R1638:Ctnnal1 UTSW 4 56813856 missense probably benign 0.06
R1871:Ctnnal1 UTSW 4 56812534 missense probably benign 0.06
R1954:Ctnnal1 UTSW 4 56817242 splice site probably benign
R2050:Ctnnal1 UTSW 4 56835350 missense probably benign 0.38
R2104:Ctnnal1 UTSW 4 56812329 makesense probably null
R3104:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3106:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3918:Ctnnal1 UTSW 4 56865000 missense possibly damaging 0.89
R4705:Ctnnal1 UTSW 4 56812579 missense probably benign 0.09
R4757:Ctnnal1 UTSW 4 56847980 missense probably damaging 1.00
R4780:Ctnnal1 UTSW 4 56847857 missense probably damaging 1.00
R4988:Ctnnal1 UTSW 4 56847854 nonsense probably null
R5771:Ctnnal1 UTSW 4 56826328 missense probably benign 0.00
R5974:Ctnnal1 UTSW 4 56817067 missense probably damaging 1.00
R6061:Ctnnal1 UTSW 4 56812349 missense probably benign
R6129:Ctnnal1 UTSW 4 56829573 missense possibly damaging 0.93
R6389:Ctnnal1 UTSW 4 56813849 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCTCTGTTCACAGTACTCCATC -3'
(R):5'- CACAGACAGGTCAGGAACCATTCTC -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- gtgactggtgtgactggtg -3'
Posted On2014-05-23