Incidental Mutation 'R1760:Tmem94'
ID192716
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Nametransmembrane protein 94
Synonyms2310067B10Rik
MMRRC Submission 039792-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R1760 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115765433-115799366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115796754 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1146 (K1146N)
Ref Sequence ENSEMBL: ENSMUSP00000099322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041684] [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000125918]
Predicted Effect probably benign
Transcript: ENSMUST00000041684
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093912
AA Change: K1146N

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: K1146N

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103033
AA Change: K1146N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: K1146N

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125658
Predicted Effect probably benign
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175989
Meta Mutation Damage Score 0.0256 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh23 G A 10: 60,326,076 T1997M probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 M235K probably damaging Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Kpna3 T C 14: 61,370,541 E405G probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Nek9 T G 12: 85,305,590 D833A possibly damaging Het
Nek9 T C 12: 85,310,410 E660G probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rab3ip C T 10: 116,937,510 D133N probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc38a11 C T 2: 65,355,319 probably null Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vegfa A G 17: 46,025,469 Y242H probably damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115795328 missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115790284 missense probably benign 0.25
IGL01314:Tmem94 APN 11 115790009 missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115787538 missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115797432 missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115793071 missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115796401 nonsense probably null
IGL02816:Tmem94 APN 11 115788704 unclassified probably null
IGL02836:Tmem94 APN 11 115792939 missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115792421 missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115792398 missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115792068 unclassified probably benign
IGL03397:Tmem94 APN 11 115787568 unclassified probably benign
capitulate UTSW 11 115796746 missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115796724 unclassified probably benign
R0336:Tmem94 UTSW 11 115787385 missense probably benign
R0370:Tmem94 UTSW 11 115788717 missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115794781 splice site probably null
R0638:Tmem94 UTSW 11 115792060 unclassified probably null
R0647:Tmem94 UTSW 11 115796795 missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115791978 missense probably benign 0.00
R1469:Tmem94 UTSW 11 115795091 unclassified probably benign
R1616:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R1621:Tmem94 UTSW 11 115785845 missense probably benign
R1682:Tmem94 UTSW 11 115790230 missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115794748 missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115793213 nonsense probably null
R1926:Tmem94 UTSW 11 115792900 missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115788674 missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115794328 missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115794749 missense probably benign
R2419:Tmem94 UTSW 11 115796815 missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115791961 missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115789254 missense probably benign 0.00
R4708:Tmem94 UTSW 11 115786295 missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115796112 nonsense probably null
R5026:Tmem94 UTSW 11 115793104 missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115793190 missense probably benign 0.04
R5716:Tmem94 UTSW 11 115792428 missense probably benign 0.17
R6180:Tmem94 UTSW 11 115791031 critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115796746 missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115798286 missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115791988 missense probably damaging 1.00
R6885:Tmem94 UTSW 11 115796461 missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115785830 missense possibly damaging 0.47
X0024:Tmem94 UTSW 11 115786253 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATAGTCACGAGCCTCTGTGTACCC -3'
(R):5'- GTTTAGCAAGCCCTCAGCAGGTAAG -3'

Sequencing Primer
(F):5'- AAGATGTTGAGTCTCCTGAGCC -3'
(R):5'- TCAGCAGGTAAGTGCCCAC -3'
Posted On2014-05-23