Incidental Mutation 'R1760:Nek9'
ID192717
Institutional Source Beutler Lab
Gene Symbol Nek9
Ensembl Gene ENSMUSG00000034290
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 9
SynonymsC130021H08Rik
MMRRC Submission 039792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1760 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85299514-85339362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85305590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 833 (D833A)
Ref Sequence ENSEMBL: ENSMUSP00000049056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040992
AA Change: D833A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290
AA Change: D833A

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein is activated in mitosis and, in turn, activates other family members during mitosis. This protein also mediates cellular processes that are essential for interphase progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh23 G A 10: 60,326,076 T1997M probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 M235K probably damaging Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Kpna3 T C 14: 61,370,541 E405G probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rab3ip C T 10: 116,937,510 D133N probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc38a11 C T 2: 65,355,319 probably null Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Tmem94 A T 11: 115,796,754 K1146N probably damaging Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vegfa A G 17: 46,025,469 Y242H probably damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Nek9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Nek9 APN 12 85314587 missense probably benign 0.23
IGL01595:Nek9 APN 12 85314420 missense probably damaging 1.00
IGL01603:Nek9 APN 12 85305605 missense probably damaging 1.00
IGL01893:Nek9 APN 12 85336400 missense probably damaging 1.00
IGL02017:Nek9 APN 12 85329923 missense probably damaging 1.00
IGL02197:Nek9 APN 12 85307930 missense probably null
IGL02207:Nek9 APN 12 85303483 nonsense probably null
IGL02749:Nek9 APN 12 85305507 missense probably benign 0.02
IGL02756:Nek9 APN 12 85311336 critical splice donor site probably null
IGL03343:Nek9 APN 12 85303609 missense probably damaging 1.00
Rose_colored UTSW 12 85303537 missense probably damaging 1.00
R0048:Nek9 UTSW 12 85301899 missense probably benign 0.17
R0331:Nek9 UTSW 12 85327375 splice site probably benign
R0499:Nek9 UTSW 12 85301883 missense probably benign 0.09
R1484:Nek9 UTSW 12 85301848 missense probably damaging 1.00
R1760:Nek9 UTSW 12 85310410 missense probably benign 0.00
R1883:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1884:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1999:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2046:Nek9 UTSW 12 85320707 splice site probably benign
R2096:Nek9 UTSW 12 85314548 missense probably benign 0.00
R2150:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2368:Nek9 UTSW 12 85329887 missense possibly damaging 0.89
R2570:Nek9 UTSW 12 85332546 nonsense probably null
R4381:Nek9 UTSW 12 85329858 missense probably damaging 1.00
R4570:Nek9 UTSW 12 85320734 missense probably damaging 1.00
R4661:Nek9 UTSW 12 85320892 missense possibly damaging 0.78
R4669:Nek9 UTSW 12 85314204 missense probably benign 0.00
R4993:Nek9 UTSW 12 85310420 missense probably damaging 1.00
R5071:Nek9 UTSW 12 85327459 missense possibly damaging 0.70
R5090:Nek9 UTSW 12 85329842 critical splice donor site probably null
R5248:Nek9 UTSW 12 85308977 missense probably damaging 1.00
R5521:Nek9 UTSW 12 85327445 missense probably benign 0.09
R5734:Nek9 UTSW 12 85303515 missense probably benign
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6269:Nek9 UTSW 12 85332329 intron probably null
R6353:Nek9 UTSW 12 85301829 missense probably damaging 0.96
R6406:Nek9 UTSW 12 85339172 missense probably damaging 0.97
R6744:Nek9 UTSW 12 85329929 missense probably benign 0.09
R6922:Nek9 UTSW 12 85303537 missense probably damaging 1.00
X0052:Nek9 UTSW 12 85322027 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCACAAACAGCCACTGTCAGTTAC -3'
(R):5'- CTTTCCCACCCGTGAAGACATCTG -3'

Sequencing Primer
(F):5'- CCACTGTCAGTTACCCAGG -3'
(R):5'- gttccacttgtctctgtttcc -3'
Posted On2014-05-23