Incidental Mutation 'R1760:Vegfa'
ID192736
Institutional Source Beutler Lab
Gene Symbol Vegfa
Ensembl Gene ENSMUSG00000023951
Gene Namevascular endothelial growth factor A
SynonymsVEGF-A, VPF, VEGF164, VEGF120, VEGF188, Vegf
MMRRC Submission 039792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1760 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46016993-46032369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46025469 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 242 (Y242H)
Ref Sequence ENSEMBL: ENSMUSP00000115883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024747] [ENSMUST00000071648] [ENSMUST00000113519] [ENSMUST00000113520] [ENSMUST00000142351] [ENSMUST00000167860] [ENSMUST00000214739] [ENSMUST00000217017]
Predicted Effect probably damaging
Transcript: ENSMUST00000024747
AA Change: Y64H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024747
Gene: ENSMUSG00000023951
AA Change: Y64H

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000071648
AA Change: Y242H

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071575
Gene: ENSMUSG00000023951
AA Change: Y242H

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 312 368 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113519
AA Change: Y64H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109147
Gene: ENSMUSG00000023951
AA Change: Y64H

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
low complexity region 140 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113520
AA Change: Y64H

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109148
Gene: ENSMUSG00000023951
AA Change: Y64H

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Pfam:VEGF_C 154 208 9.5e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142321
Predicted Effect probably damaging
Transcript: ENSMUST00000142351
AA Change: Y242H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115883
Gene: ENSMUSG00000023951
AA Change: Y242H

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 339 392 1.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150327
Predicted Effect probably damaging
Transcript: ENSMUST00000167860
AA Change: Y242H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131901
Gene: ENSMUSG00000023951
AA Change: Y242H

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214739
AA Change: Y242H

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000217017
AA Change: Y242H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.[provided by RefSeq, Nov 2015]
PHENOTYPE: Hetero- or homozygous null mutants show embryonic lethality with impaired angiogenesis and blood-island formation. Mutants selectively expressing isoform 120 or 188 exhibit vascular outgrowth/patterning defects or impaired arterial development, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,330 probably null Het
2310035C23Rik T G 1: 105,719,444 probably benign Het
Abca2 T C 2: 25,443,043 S1585P probably benign Het
Abhd16b T C 2: 181,493,404 F33S probably damaging Het
Adgra2 G A 8: 27,119,767 R856Q probably damaging Het
Aff3 A T 1: 38,329,864 probably benign Het
Anxa2 A T 9: 69,489,767 Y251F probably benign Het
Arid1b A G 17: 5,341,813 T1873A probably damaging Het
Baz1b C A 5: 135,242,524 D1320E probably benign Het
Bbs1 A T 19: 4,894,322 S426R probably benign Het
Bid A G 6: 120,900,248 V44A possibly damaging Het
Ccdc60 T A 5: 116,172,473 M177L probably damaging Het
Cdh23 G A 10: 60,326,076 T1997M probably damaging Het
Cdh5 T A 8: 104,128,169 M243K probably benign Het
Clpb T A 7: 101,786,698 V578E possibly damaging Het
Cngb1 C A 8: 95,299,700 C151F probably benign Het
Cntnap5b T C 1: 99,772,810 S16P probably benign Het
Cr1l T A 1: 195,114,815 M305L probably benign Het
Ctnnal1 A T 4: 56,838,988 M235K probably damaging Het
Ddx55 A T 5: 124,568,113 R534W probably damaging Het
Dip2b T A 15: 100,212,029 L1465Q probably damaging Het
Dnah9 G T 11: 65,981,222 D2727E probably benign Het
Dph3b-ps A C 13: 106,546,989 noncoding transcript Het
Dst T A 1: 34,228,603 L2702Q probably damaging Het
Efnb2 T C 8: 8,623,184 T158A possibly damaging Het
Exosc10 A T 4: 148,578,469 K712* probably null Het
Fgr T C 4: 132,998,342 V354A possibly damaging Het
Fsip2 G A 2: 82,984,896 V3658M probably benign Het
Fsip2 A T 2: 82,987,711 H4596L possibly damaging Het
Fsip2 A G 2: 82,999,841 D6893G possibly damaging Het
Gm1527 G A 3: 28,895,550 probably benign Het
Gm5150 G T 3: 16,006,304 Q7K probably benign Het
Gpr155 C T 2: 73,381,935 V115M probably damaging Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsn T A 2: 35,284,823 Y127N probably damaging Het
Hk1 A G 10: 62,281,899 L615S probably damaging Het
Igsf9b A G 9: 27,317,827 T194A possibly damaging Het
Il17rd C T 14: 27,091,806 Q46* probably null Het
Jak1 T A 4: 101,162,929 M678L probably benign Het
Kif6 T C 17: 49,615,283 V16A probably benign Het
Kpna3 T C 14: 61,370,541 E405G probably benign Het
Lmtk2 C A 5: 144,174,175 T571K probably damaging Het
Mucl2 T C 15: 103,897,572 T40A possibly damaging Het
Myh11 G A 16: 14,233,695 probably benign Het
Myh7 C T 14: 54,972,713 R1845Q probably damaging Het
Myo1f T A 17: 33,586,198 L480Q probably benign Het
Nek9 T G 12: 85,305,590 D833A possibly damaging Het
Nek9 T C 12: 85,310,410 E660G probably benign Het
Olfr186 T C 16: 59,026,987 R307G probably benign Het
Olfr315 A G 11: 58,778,369 M81V possibly damaging Het
Olfr419 C T 1: 174,250,360 C189Y probably damaging Het
Olfr446 A G 6: 42,927,497 I89V possibly damaging Het
Olfr523 G A 7: 140,176,275 V52M probably damaging Het
Olfr808 T A 10: 129,767,548 D17E probably benign Het
Olfr831-ps1 T A 9: 18,932,495 probably benign Het
Otud3 G T 4: 138,895,781 T383K possibly damaging Het
Pkp4 T C 2: 59,311,841 L496P probably damaging Het
Pla2g4e C A 2: 120,170,046 A737S possibly damaging Het
Pla2g4f T C 2: 120,314,066 probably benign Het
Plxnd1 A T 6: 115,967,779 V1018E possibly damaging Het
Ppp1r21 T G 17: 88,562,225 V402G possibly damaging Het
Prkcq T G 2: 11,300,070 M690R probably damaging Het
Ptpra T C 2: 130,549,827 I719T probably damaging Het
Rab3ip C T 10: 116,937,510 D133N probably damaging Het
Rsbn1 T A 3: 103,960,031 Y563N probably damaging Het
Rtf1 A C 2: 119,728,408 D530A probably benign Het
Rybp G T 6: 100,232,263 S199R probably benign Het
Sema5a T G 15: 32,641,106 C689G probably damaging Het
Senp6 T A 9: 80,118,629 V314E probably benign Het
Setd1a T A 7: 127,785,890 C47S possibly damaging Het
Slamf1 C A 1: 171,777,166 T168K probably benign Het
Slc12a5 T C 2: 164,996,128 S937P probably damaging Het
Slc38a11 C T 2: 65,355,319 probably null Het
Slc6a2 C T 8: 92,961,218 probably benign Het
Snw1 A T 12: 87,464,689 F64Y probably benign Het
Spata9 A C 13: 75,998,524 I172L probably benign Het
Sphkap T C 1: 83,277,544 H828R probably benign Het
Tmem94 A T 11: 115,796,754 K1146N probably damaging Het
Trdn A G 10: 33,233,887 T294A possibly damaging Het
Tsc22d1 T C 14: 76,416,948 V289A possibly damaging Het
Tti1 C A 2: 157,993,035 V1002L possibly damaging Het
Tubgcp4 T A 2: 121,189,471 probably null Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Uvrag A G 7: 98,888,348 S547P probably benign Het
Vav3 T C 3: 109,341,127 V30A possibly damaging Het
Vmn2r75 G T 7: 86,148,811 T598K probably damaging Het
Vps13b C T 15: 35,884,619 S3146L possibly damaging Het
Vrk3 A G 7: 44,768,471 Y310C probably damaging Het
Zfhx4 A G 3: 5,382,616 K1100R probably benign Het
Zfp748 T A 13: 67,545,421 probably null Het
Zfp760 A T 17: 21,722,330 D162V probably damaging Het
Znfx1 T A 2: 167,039,866 M1068L probably damaging Het
Other mutations in Vegfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Vegfa APN 17 46025421 missense possibly damaging 0.88
IGL02859:Vegfa APN 17 46024495 missense probably benign 0.43
R1442:Vegfa UTSW 17 46025492 missense possibly damaging 0.85
R1982:Vegfa UTSW 17 46018860 makesense probably null
R2012:Vegfa UTSW 17 46025358 missense probably benign 0.21
R3729:Vegfa UTSW 17 46024520 missense possibly damaging 0.80
R4276:Vegfa UTSW 17 46031466 missense probably benign
R4277:Vegfa UTSW 17 46031466 missense probably benign
R4279:Vegfa UTSW 17 46031466 missense probably benign
R4654:Vegfa UTSW 17 46025250 intron probably benign
R4696:Vegfa UTSW 17 46028346 splice site probably null
X0026:Vegfa UTSW 17 46025526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCCAGACAACCTTCTAATGC -3'
(R):5'- TGTACCCAGACTCAGGCTGTCATC -3'

Sequencing Primer
(F):5'- GACAACCTTCTAATGCCCCTC -3'
(R):5'- ACTCAGGCTGTCATCTGGAG -3'
Posted On2014-05-23