Incidental Mutation 'R1761:Cr2'
ID192741
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 195155123 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably null
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192604
Predicted Effect probably benign
Transcript: ENSMUST00000193356
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195737
Predicted Effect probably null
Transcript: ENSMUST00000210219
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGCTGCACCTCACTAGCAAG -3'
(R):5'- CTAACTCATTGCCCCGATCCAGAAG -3'

Sequencing Primer
(F):5'- GAAGGTCAGCTTCATTCTTCATTAC -3'
(R):5'- GATCCAGAAGTCAAACATGGTTAC -3'
Posted On2014-05-23