Incidental Mutation 'R1761:Tet3'
ID192766
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Nametet methylcytosine dioxygenase 3
SynonymsD230004J03Rik, B430006D22Rik
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83362373-83459084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83403659 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 509 (E509G)
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548] [ENSMUST00000190295]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056191
Predicted Effect probably damaging
Transcript: ENSMUST00000089622
AA Change: E374G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: E374G

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184003
Predicted Effect probably damaging
Transcript: ENSMUST00000186548
AA Change: E509G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: E509G

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190295
SMART Domains Protein: ENSMUSP00000139679
Gene: ENSMUSG00000034832

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83368655 missense probably benign 0.06
IGL01396:Tet3 APN 6 83369638 nonsense probably null
IGL02344:Tet3 APN 6 83403833 missense probably benign 0.04
IGL02987:Tet3 APN 6 83368092 missense probably damaging 0.99
IGL03126:Tet3 APN 6 83376787 missense probably damaging 1.00
IGL03155:Tet3 APN 6 83368383 missense probably damaging 1.00
IGL03286:Tet3 APN 6 83375778 missense probably damaging 1.00
Reedy UTSW 6 83368084 nonsense probably null
P0033:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R0131:Tet3 UTSW 6 83368788 missense probably damaging 1.00
R0295:Tet3 UTSW 6 83369139 missense probably benign 0.14
R0504:Tet3 UTSW 6 83373794 missense probably damaging 1.00
R0524:Tet3 UTSW 6 83379942 missense probably damaging 1.00
R1061:Tet3 UTSW 6 83373323 missense probably damaging 0.99
R1160:Tet3 UTSW 6 83404452 missense probably benign 0.00
R1550:Tet3 UTSW 6 83386028 missense probably damaging 0.97
R1640:Tet3 UTSW 6 83369315 missense probably benign 0.44
R1658:Tet3 UTSW 6 83369057 missense probably benign 0.44
R1746:Tet3 UTSW 6 83368068 missense probably damaging 1.00
R1832:Tet3 UTSW 6 83403645 missense probably benign
R1835:Tet3 UTSW 6 83404163 missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83404379 missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83386075 missense probably damaging 1.00
R2230:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2232:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2922:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R3429:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R3430:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R4291:Tet3 UTSW 6 83373199 missense probably damaging 1.00
R4349:Tet3 UTSW 6 83403275 missense probably benign
R4809:Tet3 UTSW 6 83402946 missense probably benign
R4846:Tet3 UTSW 6 83376883 nonsense probably null
R5039:Tet3 UTSW 6 83375896 missense probably damaging 1.00
R5233:Tet3 UTSW 6 83386063 missense probably damaging 1.00
R5363:Tet3 UTSW 6 83376764 critical splice donor site probably null
R5880:Tet3 UTSW 6 83370550 missense probably damaging 1.00
R6270:Tet3 UTSW 6 83375791 missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83368084 nonsense probably null
R6564:Tet3 UTSW 6 83386070 missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83403444 missense probably benign 0.00
X0004:Tet3 UTSW 6 83403423 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTTGATCTGAATGGGCTTTCGGAC -3'
(R):5'- TGGCAGAACTGGAGCAGCTATTG -3'

Sequencing Primer
(F):5'- GGACACTGGTCTTGATCCC -3'
(R):5'- AGCAGCTATTGGGCAGC -3'
Posted On2014-05-23