Incidental Mutation 'R1761:Mcm2'
ID192767
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Nameminichromosome maintenance complex component 2
SynonymsBM28, CDCL1, Mcmd2
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88883474-88898780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88889788 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 412 (I412M)
Ref Sequence ENSEMBL: ENSMUSP00000061923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058011
AA Change: I412M

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: I412M

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably benign
Transcript: ENSMUST00000205165
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88893401 missense probably benign 0.04
IGL01082:Mcm2 APN 6 88887877 missense probably benign 0.05
IGL01451:Mcm2 APN 6 88891966 splice site probably benign
IGL01534:Mcm2 APN 6 88887718 critical splice donor site probably null
IGL01670:Mcm2 APN 6 88887632 unclassified probably benign
IGL01724:Mcm2 APN 6 88886062 missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88891726 missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88888236 nonsense probably null
R0254:Mcm2 UTSW 6 88884016 missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88892078 missense probably benign 0.12
R1740:Mcm2 UTSW 6 88884044 missense probably damaging 1.00
R1917:Mcm2 UTSW 6 88891803 missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88888252 missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88887804 missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88891991 missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88897450 missense probably benign
R5701:Mcm2 UTSW 6 88893091 missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88884071 missense probably benign 0.05
R6118:Mcm2 UTSW 6 88887836 missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88889909 critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88885862 missense probably benign 0.00
R6550:Mcm2 UTSW 6 88886959 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTTTGTCCCACGGTGCTTTG -3'
(R):5'- CCATGACCTTTGTCTTGTGCAGACC -3'

Sequencing Primer
(F):5'- agaccctgacacatctccc -3'
(R):5'- TCTTGTGCAGACCATCTATCAGAAC -3'
Posted On2014-05-23