Incidental Mutation 'R1761:Timm10b'
ID192773
Institutional Source Beutler Lab
Gene Symbol Timm10b
Ensembl Gene ENSMUSG00000089847
Gene Nametranslocase of inner mitochondrial membrane 10B
SynonymsFxC1, Fracture Callus 1, Tim9b, Tim10b
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105640056-105643637 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 105683708 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 897 (R897*)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106776] [ENSMUST00000142874] [ENSMUST00000145988]
Predicted Effect probably null
Transcript: ENSMUST00000106776
AA Change: R159*
SMART Domains Protein: ENSMUSP00000102388
Gene: ENSMUSG00000030882
AA Change: R159*

DomainStartEndE-ValueType
low complexity region 205 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably null
Transcript: ENSMUST00000145988
AA Change: R897*
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: R897*

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FXC1, or TIMM10B, belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Timm10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Timm10b APN 7 105641138 nonsense probably null
IGL02642:Timm10b APN 7 105668438 splice site probably benign
IGL02689:Timm10b APN 7 105640632 splice site probably benign
R0413:Timm10b UTSW 7 105678330 missense probably benign 0.11
R0635:Timm10b UTSW 7 105640688 intron probably benign
R4525:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4527:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4528:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4839:Timm10b UTSW 7 105684012 missense probably damaging 1.00
R5007:Timm10b UTSW 7 105641091 missense probably damaging 1.00
R5313:Timm10b UTSW 7 105641080 missense probably damaging 1.00
R5632:Timm10b UTSW 7 105641122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTCTGATCCTAGAATGCCCTC -3'
(R):5'- TTGCTGAGCAGGAACTCTGAAACC -3'

Sequencing Primer
(F):5'- TAGAGCCTCTAGATGTCAACCCTG -3'
(R):5'- GGAACTCTGAAACCTGGCTTC -3'
Posted On2014-05-23