Incidental Mutation 'R1761:Tom1'
ID192777
Institutional Source Beutler Lab
Gene Symbol Tom1
Ensembl Gene ENSMUSG00000042870
Gene Nametarget of myb1 trafficking protein
Synonyms
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location75033705-75070121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75051551 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000077891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078847] [ENSMUST00000165630] [ENSMUST00000211869] [ENSMUST00000212299] [ENSMUST00000212388] [ENSMUST00000212564] [ENSMUST00000212651]
Predicted Effect probably benign
Transcript: ENSMUST00000078847
AA Change: V87A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077891
Gene: ENSMUSG00000042870
AA Change: V87A

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 228 303 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165630
AA Change: V87A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130854
Gene: ENSMUSG00000042870
AA Change: V87A

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 212 312 5.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211938
Predicted Effect probably benign
Transcript: ENSMUST00000212299
Predicted Effect probably benign
Transcript: ENSMUST00000212388
Predicted Effect probably benign
Transcript: ENSMUST00000212564
AA Change: Y61H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212651
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a target of the v-myb oncogene. The encoded protein shares its N-terminal domain in common with proteins associated with vesicular trafficking at the endosome. It is recruited to the endosomes by its interaction with endofin. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Tom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tom1 APN 8 75052174 missense probably benign 0.27
IGL00979:Tom1 APN 8 75054703 unclassified probably benign
IGL01143:Tom1 APN 8 75058457 missense probably benign 0.00
IGL02825:Tom1 APN 8 75057255 missense probably damaging 1.00
R0335:Tom1 UTSW 8 75064392 critical splice acceptor site probably null
R0762:Tom1 UTSW 8 75052306 splice site probably benign
R1317:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1509:Tom1 UTSW 8 75054631 missense probably damaging 1.00
R1691:Tom1 UTSW 8 75051599 missense probably damaging 1.00
R1906:Tom1 UTSW 8 75051590 missense probably damaging 1.00
R3966:Tom1 UTSW 8 75059239 missense probably benign 0.05
R5004:Tom1 UTSW 8 75052002 missense probably damaging 1.00
R5513:Tom1 UTSW 8 75057220 missense probably damaging 0.99
R5906:Tom1 UTSW 8 75050258 missense probably damaging 1.00
R6147:Tom1 UTSW 8 75054692 missense possibly damaging 0.90
R6964:Tom1 UTSW 8 75051965 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGTAGGAAGGGAGTCTTGTCTGTC -3'
(R):5'- GCAGCTCACTAGCAGAGTAGAATAGCC -3'

Sequencing Primer
(F):5'- GTCTGTCCTGTCATGTCCCAG -3'
(R):5'- GAGTAGAATAGCCCCAGAATTCC -3'
Posted On2014-05-23