Incidental Mutation 'R1761:Gpr179'
ID192790
Institutional Source Beutler Lab
Gene Symbol Gpr179
Ensembl Gene ENSMUSG00000070337
Gene NameG protein-coupled receptor 179
Synonyms5330439C02Rik
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97332109-97352077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 97335106 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 2074 (S2074R)
Ref Sequence ENSEMBL: ENSMUSP00000091474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093942]
Predicted Effect probably benign
Transcript: ENSMUST00000093942
AA Change: S2074R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: S2074R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 41 N/A INTRINSIC
EGF 281 357 1.91e1 SMART
Pfam:7tm_3 391 633 3.2e-40 PFAM
low complexity region 735 759 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 959 988 N/A INTRINSIC
low complexity region 1107 1125 N/A INTRINSIC
internal_repeat_2 1156 1467 1.99e-12 PROSPERO
internal_repeat_1 1235 1674 2.85e-27 PROSPERO
internal_repeat_2 1569 1879 1.99e-12 PROSPERO
internal_repeat_1 1756 2284 2.85e-27 PROSPERO
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cpne8 A G 15: 90,648,618 V62A probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Gpr179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Gpr179 APN 11 97337801 missense probably damaging 0.99
IGL01152:Gpr179 APN 11 97337411 missense probably benign 0.08
IGL01402:Gpr179 APN 11 97338186 nonsense probably null
IGL01404:Gpr179 APN 11 97338186 nonsense probably null
IGL01773:Gpr179 APN 11 97341366 missense probably benign 0.05
IGL02682:Gpr179 APN 11 97351865 missense probably benign
IGL02728:Gpr179 APN 11 97337900 missense probably damaging 0.99
IGL03243:Gpr179 APN 11 97351475 missense probably benign 0.02
IGL03272:Gpr179 APN 11 97336593 missense possibly damaging 0.89
IGL03347:Gpr179 APN 11 97351838 missense probably damaging 1.00
IGL03355:Gpr179 APN 11 97337608 missense possibly damaging 0.57
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0080:Gpr179 UTSW 11 97351469 missense probably benign 0.08
R0255:Gpr179 UTSW 11 97336066 missense probably benign 0.24
R0412:Gpr179 UTSW 11 97338807 missense probably damaging 1.00
R0481:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R0612:Gpr179 UTSW 11 97338438 missense possibly damaging 0.86
R0786:Gpr179 UTSW 11 97343274 missense probably damaging 1.00
R1753:Gpr179 UTSW 11 97346578 missense probably damaging 1.00
R1796:Gpr179 UTSW 11 97336556 missense possibly damaging 0.86
R1969:Gpr179 UTSW 11 97337958 missense probably benign
R2240:Gpr179 UTSW 11 97351733 missense probably damaging 1.00
R3855:Gpr179 UTSW 11 97341434 missense probably damaging 1.00
R3913:Gpr179 UTSW 11 97334765 missense probably benign 0.01
R4484:Gpr179 UTSW 11 97335711 missense probably benign 0.28
R4806:Gpr179 UTSW 11 97349784 missense possibly damaging 0.55
R4816:Gpr179 UTSW 11 97339248 missense probably damaging 0.99
R4906:Gpr179 UTSW 11 97346661 missense possibly damaging 0.87
R4945:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R5191:Gpr179 UTSW 11 97338149 missense possibly damaging 0.76
R5273:Gpr179 UTSW 11 97347430 missense probably damaging 1.00
R5317:Gpr179 UTSW 11 97337845 missense probably damaging 1.00
R5459:Gpr179 UTSW 11 97336657 missense probably benign 0.00
R5507:Gpr179 UTSW 11 97338330 missense probably damaging 1.00
R5523:Gpr179 UTSW 11 97336782 missense probably benign 0.37
R5536:Gpr179 UTSW 11 97343815 missense probably damaging 1.00
R5591:Gpr179 UTSW 11 97345755 missense probably benign 0.17
R5679:Gpr179 UTSW 11 97336745 missense probably benign 0.20
R5738:Gpr179 UTSW 11 97351406 missense probably damaging 1.00
R5829:Gpr179 UTSW 11 97335698 missense probably benign 0.11
R5836:Gpr179 UTSW 11 97339056 missense probably benign 0.03
R6007:Gpr179 UTSW 11 97335802 nonsense probably null
R6047:Gpr179 UTSW 11 97338416 missense probably damaging 1.00
R6339:Gpr179 UTSW 11 97344176 missense probably damaging 1.00
R6383:Gpr179 UTSW 11 97337147 missense possibly damaging 0.88
R6674:Gpr179 UTSW 11 97347405 critical splice donor site probably null
R6712:Gpr179 UTSW 11 97336167 missense possibly damaging 0.94
R6835:Gpr179 UTSW 11 97347467 missense probably damaging 1.00
X0065:Gpr179 UTSW 11 97347438 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTGCTTGCTCCATGAAGACCAAC -3'
(R):5'- CCTGAAACACGAGATCACGAAGGTG -3'

Sequencing Primer
(F):5'- TCTGCTGCCTTCAAGAGATG -3'
(R):5'- CACAGACCAGCAACTTTGGG -3'
Posted On2014-05-23