Incidental Mutation 'R1761:Cpne8'
ID192802
Institutional Source Beutler Lab
Gene Symbol Cpne8
Ensembl Gene ENSMUSG00000052560
Gene Namecopine VIII
Synonyms1200003E11Rik, 1500031E20Rik
MMRRC Submission 039793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1761 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location90487482-90679432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90648618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 62 (V62A)
Ref Sequence ENSEMBL: ENSMUSP00000086024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014777] [ENSMUST00000064391] [ENSMUST00000088649]
Predicted Effect probably damaging
Transcript: ENSMUST00000014777
AA Change: V62A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014777
Gene: ENSMUSG00000052560
AA Change: V62A

DomainStartEndE-ValueType
Blast:C2 37 75 6e-21 BLAST
SCOP:d1bdya_ 38 64 9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064391
AA Change: V62A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067774
Gene: ENSMUSG00000052560
AA Change: V62A

DomainStartEndE-ValueType
C2 37 145 9.76e-10 SMART
C2 170 277 1.06e-10 SMART
low complexity region 284 291 N/A INTRINSIC
VWA 320 518 1.34e-9 SMART
low complexity region 559 569 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088649
AA Change: V62A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086024
Gene: ENSMUSG00000052560
AA Change: V62A

DomainStartEndE-ValueType
C2 37 139 8.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154569
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the copine family of highly conserved, calcium-dependent phospholipid binding proteins. The encoded protein has two characteristic C2 domains and a VWFA domain and may play a role in membrane trafficking. A related pseudogene is found on chromosome 8. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik G A 4: 41,507,223 P109L probably damaging Het
Abi3bp C T 16: 56,668,309 H1268Y possibly damaging Het
Acan T A 7: 79,094,085 Y621* probably null Het
Aig1 T C 10: 13,690,584 Y152C probably damaging Het
Arhgap33 C T 7: 30,533,063 probably null Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Cbx5 T C 15: 103,213,180 D10G possibly damaging Het
Ccdc191 A G 16: 43,943,510 I445V probably benign Het
Cdk4 T A 10: 127,064,677 probably null Het
Chil6 A G 3: 106,394,338 F149L probably damaging Het
Cntn5 T C 9: 10,172,054 T42A probably benign Het
Cpn2 A T 16: 30,260,196 I229N probably damaging Het
Cr2 A G 1: 195,155,123 probably null Het
Crnn A T 3: 93,148,651 H248L probably benign Het
Csn1s1 A G 5: 87,679,035 S254G probably benign Het
Cubn A G 2: 13,489,317 probably null Het
Dnah8 A G 17: 30,779,916 N3525S probably damaging Het
Dpp3 A G 19: 4,921,149 L220P probably benign Het
Fam110a T C 2: 151,970,205 E215G probably benign Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Fat4 T C 3: 38,887,489 V177A possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gimap5 A T 6: 48,753,261 Q255L probably damaging Het
Gm13083 T C 4: 143,615,868 Y182H probably benign Het
Gm4787 A G 12: 81,377,176 L736S probably benign Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Gpr179 A C 11: 97,335,106 S2074R probably benign Het
Hddc2 G T 10: 31,326,139 D161Y probably damaging Het
Hlcs T C 16: 94,268,007 D265G probably benign Het
Hspg2 A T 4: 137,514,673 I573F possibly damaging Het
Il1b T C 2: 129,365,181 K220E probably damaging Het
Il5 T C 11: 53,723,730 I66T probably damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Lmf2 A G 15: 89,352,713 V442A possibly damaging Het
Mcm2 T C 6: 88,889,788 I412M possibly damaging Het
Mlkl T A 8: 111,333,723 L18F possibly damaging Het
Mug2 C A 6: 122,074,705 H949N probably benign Het
Nf1 T C 11: 79,384,265 F51L probably damaging Het
Olfr1049 T G 2: 86,255,039 Y218S probably damaging Het
Olfr592 T G 7: 103,187,118 C172W probably damaging Het
Olfr77 A T 9: 19,921,149 *313C probably null Het
P3h2 T C 16: 25,985,050 E322G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptdss1 T C 13: 66,956,412 V116A possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Scg3 T A 9: 75,676,758 I154F probably damaging Het
Scgn A T 13: 23,959,706 F225Y probably damaging Het
Sec61b T C 4: 47,480,137 C58R possibly damaging Het
Slc25a46 G T 18: 31,607,262 Q96K possibly damaging Het
Sptb A G 12: 76,612,608 F1173L probably damaging Het
Srcap T A 7: 127,534,845 C893S probably damaging Het
Tet3 T C 6: 83,403,659 E509G probably damaging Het
Timm10b C T 7: 105,683,708 R897* probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Tti1 T C 2: 158,007,697 I541V probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vgll3 A T 16: 65,839,728 D310V probably damaging Het
Vmac A G 17: 56,715,788 L74P probably damaging Het
Zbtb1 A T 12: 76,385,821 K194* probably null Het
Zfp429 A G 13: 67,396,076 M76T probably benign Het
Zfp808 T A 13: 62,171,646 C230S possibly damaging Het
Zfp980 A G 4: 145,702,042 Y447C probably damaging Het
Zfp985 A G 4: 147,584,045 T457A probably benign Het
Other mutations in Cpne8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Cpne8 APN 15 90497058 splice site probably benign
IGL00545:Cpne8 APN 15 90540259 missense probably benign
IGL00951:Cpne8 APN 15 90601893 intron probably benign
IGL01069:Cpne8 APN 15 90615110 critical splice donor site probably null
IGL01294:Cpne8 APN 15 90501445 missense probably damaging 0.96
IGL01720:Cpne8 APN 15 90501500 missense probably benign 0.01
IGL01843:Cpne8 APN 15 90569497 missense probably benign 0.17
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0096:Cpne8 UTSW 15 90499915 missense probably benign 0.24
R0545:Cpne8 UTSW 15 90497075 missense probably damaging 1.00
R0637:Cpne8 UTSW 15 90648621 missense probably damaging 1.00
R0834:Cpne8 UTSW 15 90540259 missense probably benign
R0894:Cpne8 UTSW 15 90649271 missense probably damaging 0.97
R1568:Cpne8 UTSW 15 90619642 missense probably damaging 0.98
R1629:Cpne8 UTSW 15 90571972 missense probably benign 0.03
R1747:Cpne8 UTSW 15 90584915 missense probably benign 0.00
R1884:Cpne8 UTSW 15 90648628 splice site probably benign
R2357:Cpne8 UTSW 15 90619674 missense probably damaging 0.99
R2434:Cpne8 UTSW 15 90509511 missense probably benign 0.07
R4043:Cpne8 UTSW 15 90572001 missense probably damaging 1.00
R4875:Cpne8 UTSW 15 90648568 splice site probably benign
R4969:Cpne8 UTSW 15 90619726 missense probably damaging 1.00
R4981:Cpne8 UTSW 15 90679235 missense probably benign 0.05
R5086:Cpne8 UTSW 15 90648568 splice site probably benign
R5154:Cpne8 UTSW 15 90499918 missense probably benign 0.10
R5199:Cpne8 UTSW 15 90648609 missense probably benign 0.10
R5424:Cpne8 UTSW 15 90516057 missense probably benign 0.00
R5528:Cpne8 UTSW 15 90619690 missense possibly damaging 0.95
R5946:Cpne8 UTSW 15 90488988 makesense probably null
R6158:Cpne8 UTSW 15 90571988 missense probably damaging 1.00
R6977:Cpne8 UTSW 15 90497091 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCTGGAAGACTGCATGAGATGCTC -3'
(R):5'- TACTTTTGCCCCAGGTTGGCAC -3'

Sequencing Primer
(F):5'- ATGCTCAGGAGTGCAATTTAGC -3'
(R):5'- CCAGGTTGGCACTTTAAGTGAG -3'
Posted On2014-05-23