Incidental Mutation 'R1763:Nwd2'
ID193187
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 039795-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1763 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63808271 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1733 (S1733T)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747] [ENSMUST00000159584] [ENSMUST00000196575]
Predicted Effect probably benign
Transcript: ENSMUST00000081747
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159584
AA Change: S1733T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: S1733T

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Predicted Effect probably benign
Transcript: ENSMUST00000196575
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,110,681 V794M probably benign Het
Abca4 A T 3: 122,163,830 T772S probably damaging Het
Acox3 G A 5: 35,608,339 probably null Het
Adamts17 A G 7: 67,147,715 N1060S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Als2 T C 1: 59,174,991 Y1346C probably benign Het
Apol10b A T 15: 77,585,015 F321I probably benign Het
Atp5f1 A G 3: 105,951,589 probably null Het
Bloc1s5 A G 13: 38,619,084 probably benign Het
Btbd9 T C 17: 30,334,297 N397S possibly damaging Het
Cacna1d A G 14: 30,099,196 V1121A probably benign Het
Cad G A 5: 31,060,951 V460I probably damaging Het
Caprin2 A T 6: 148,843,121 D935E probably damaging Het
Ccdc150 A T 1: 54,354,636 K686N probably benign Het
Ccnt2 T C 1: 127,799,406 F186L possibly damaging Het
Cd5l G A 3: 87,367,880 probably null Het
Chrna7 A G 7: 63,099,252 V494A probably benign Het
Clec2i T G 6: 128,895,425 Y198* probably null Het
Col22a1 A G 15: 72,007,176 V44A probably damaging Het
Cspg4 T A 9: 56,886,979 I666N probably damaging Het
Cyp3a16 A T 5: 145,465,031 probably null Het
Dlk1 G T 12: 109,458,119 C102F probably damaging Het
Dscc1 T A 15: 55,084,139 H215L probably damaging Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Dus1l C G 11: 120,795,671 G15R probably benign Het
Eps8l1 G T 7: 4,471,823 V268L probably benign Het
F2 A C 2: 91,634,906 C104W probably damaging Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fmn2 T C 1: 174,502,266 L74P unknown Het
Frmd6 G A 12: 70,893,622 R347Q possibly damaging Het
Gabbr1 T G 17: 37,054,767 S158A probably damaging Het
Galc T C 12: 98,234,266 N295S probably damaging Het
Gm436 A G 4: 144,669,959 V401A probably benign Het
Gm6408 A T 5: 146,482,322 N49I probably damaging Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Grm8 C T 6: 27,285,867 V849I possibly damaging Het
Hmcn2 A G 2: 31,314,590 D59G probably damaging Het
Iars G A 13: 49,723,077 probably null Het
Ifi27 C T 12: 103,437,682 A127V possibly damaging Het
Ikbip A G 10: 91,096,481 N329S probably damaging Het
Ikbke T C 1: 131,265,877 T479A probably benign Het
Krt12 T A 11: 99,416,060 N472I probably damaging Het
Lmnb2 A T 10: 80,907,191 L193Q probably damaging Het
Lrriq4 T C 3: 30,650,252 V128A probably benign Het
Map4k4 C A 1: 40,000,757 probably benign Het
Mtmr7 T C 8: 40,551,811 T575A probably benign Het
Myh13 G A 11: 67,334,576 A256T probably benign Het
Napepld A G 5: 21,683,410 Y14H probably benign Het
Npr1 T C 3: 90,459,337 T552A probably damaging Het
Nudt15 A G 14: 73,521,647 F127S probably benign Het
Olfr1189 A G 2: 88,592,436 I211V probably benign Het
Olfr1257 G A 2: 89,881,129 G101E probably damaging Het
Olfr1348 T G 7: 6,501,441 I262L probably benign Het
Olfr907 A G 9: 38,499,038 Y123C probably damaging Het
Olfr96 T C 17: 37,225,430 F102L probably benign Het
Paqr7 A T 4: 134,507,098 I89F probably benign Het
Pidd1 C A 7: 141,439,630 V706L probably benign Het
Polr3c A T 3: 96,713,595 I469N probably damaging Het
Ppip5k1 A G 2: 121,348,547 Y233H probably damaging Het
Psmc3 A G 2: 91,055,995 T166A possibly damaging Het
Ptchd3 A T 11: 121,842,542 I753L probably benign Het
Rad21 T C 15: 51,978,170 K50R probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs20 C T 1: 4,910,640 R154Q probably damaging Het
Sbf1 T C 15: 89,294,425 D1449G probably damaging Het
Sema4g C T 19: 45,001,605 R708* probably null Het
Sept9 T C 11: 117,290,428 I18T probably benign Het
Serpinb6b A G 13: 32,978,058 E280G probably damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc6a21 G A 7: 45,287,734 W554* probably null Het
Slco1a4 A C 6: 141,812,731 I518R probably benign Het
Stab1 T A 14: 31,168,416 Q26L probably benign Het
Stox1 A G 10: 62,667,965 F104L probably damaging Het
Suco T C 1: 161,834,949 K638E possibly damaging Het
Synpo T C 18: 60,602,784 K458E probably damaging Het
Szt2 A T 4: 118,372,368 W2820R unknown Het
Tmtc1 C A 6: 148,294,618 G499W probably damaging Het
Tonsl A C 15: 76,638,066 S242R probably damaging Het
Trpc4 G T 3: 54,194,822 S47I possibly damaging Het
Zfp106 G A 2: 120,520,428 R1581C probably benign Het
Zfp27 A G 7: 29,895,376 L388P possibly damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGCGTTGAAGATCAAAATTGCC -3'
(R):5'- ACGGTCCTCTGCAATCACGATTTC -3'

Sequencing Primer
(F):5'- GATTTTCAACAATGCAACGCAG -3'
(R):5'- GTCCAGAAGATGCACTTTGCTT -3'
Posted On2014-05-23