Incidental Mutation 'R1764:Pkn2'
ID193257
Institutional Source Beutler Lab
Gene Symbol Pkn2
Ensembl Gene ENSMUSG00000004591
Gene Nameprotein kinase N2
SynonymsPRK2, Stk7, Prkcl2, 6030436C20Rik
MMRRC Submission 039796-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1764 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142790902-142882004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142793854 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 954 (Q954R)
Ref Sequence ENSEMBL: ENSMUSP00000134559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043812] [ENSMUST00000173830] [ENSMUST00000173913] [ENSMUST00000174422]
Predicted Effect probably damaging
Transcript: ENSMUST00000043812
AA Change: Q970R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039566
Gene: ENSMUSG00000004591
AA Change: Q970R

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 462 2.72e-8 SMART
low complexity region 535 546 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
S_TKc 656 915 7.94e-100 SMART
S_TK_X 916 980 6.77e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157170
Predicted Effect probably damaging
Transcript: ENSMUST00000173830
AA Change: Q922R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133691
Gene: ENSMUSG00000004591
AA Change: Q922R

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
low complexity region 364 380 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 522 530 N/A INTRINSIC
S_TKc 608 867 7.94e-100 SMART
S_TK_X 868 932 6.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173913
Predicted Effect probably damaging
Transcript: ENSMUST00000174422
AA Change: Q954R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134559
Gene: ENSMUSG00000004591
AA Change: Q954R

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 446 2.92e-8 SMART
low complexity region 519 530 N/A INTRINSIC
low complexity region 554 562 N/A INTRINSIC
S_TKc 640 899 7.94e-100 SMART
S_TK_X 900 964 6.77e-16 SMART
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired mesenchymal cell proliferation and neural crest cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,478,943 I24N possibly damaging Het
4930522L14Rik A G 5: 109,736,789 V401A probably benign Het
5830411N06Rik A G 7: 140,297,265 E831G probably benign Het
9930021J03Rik T A 19: 29,719,160 T978S possibly damaging Het
Abca7 G T 10: 80,008,950 W1502L probably damaging Het
Adcy7 A G 8: 88,308,840 E124G probably benign Het
Aif1l G A 2: 31,965,106 E66K probably benign Het
Aldh8a1 A T 10: 21,395,493 M373L probably benign Het
Alg6 T C 4: 99,741,578 Y131H probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arrdc4 A T 7: 68,741,874 I215K probably damaging Het
Asb4 A G 6: 5,390,798 probably null Het
Astn1 T C 1: 158,504,251 I305T probably benign Het
Atp5b T A 10: 128,084,080 probably benign Het
Atp8a1 C A 5: 67,631,567 M1044I probably benign Het
Atp9b C T 18: 80,909,591 probably null Het
Btaf1 A G 19: 36,951,118 H113R probably benign Het
C87436 G T 6: 86,453,612 C338F possibly damaging Het
Casz1 T C 4: 148,942,900 probably benign Het
Cbr3 T A 16: 93,690,482 H184Q probably damaging Het
Cct8l1 T C 5: 25,517,099 S271P possibly damaging Het
Cdc34 A G 10: 79,685,340 K77R probably benign Het
Cdc34 G T 10: 79,685,338 probably null Het
Cdh20 A G 1: 104,934,345 probably benign Het
Celsr3 A G 9: 108,828,958 E880G probably damaging Het
Cers1 T G 8: 70,321,491 probably null Het
Cntn5 T C 9: 9,673,983 I705V probably benign Het
Dennd4c T A 4: 86,803,010 D636E probably damaging Het
Dnah11 T C 12: 118,190,825 E240G probably benign Het
Dnah2 T C 11: 69,423,543 Y4100C probably damaging Het
Dpysl3 T C 18: 43,363,518 E151G probably damaging Het
Efcab9 T G 11: 32,524,457 T9P possibly damaging Het
Eif4g2 A T 7: 111,074,487 F725Y probably damaging Het
Epha6 T A 16: 59,775,728 I867F probably null Het
Erbin T C 13: 103,843,451 probably benign Het
Evi5l A G 8: 4,203,560 E468G probably damaging Het
Filip1l C T 16: 57,570,038 R330W probably damaging Het
Fmo3 C T 1: 162,958,573 V283M possibly damaging Het
Gabarapl1 A T 6: 129,533,518 K24N possibly damaging Het
Gigyf1 C T 5: 137,522,508 probably benign Het
Gm13089 C A 4: 143,698,270 C201F probably benign Het
Gm5581 T A 6: 131,181,399 noncoding transcript Het
Gon4l G T 3: 88,892,599 K850N probably damaging Het
Igf2bp3 C T 6: 49,109,046 R233H probably damaging Het
Iqcf4 G A 9: 106,568,694 R85C probably benign Het
Kalrn C T 16: 34,212,873 R473Q probably damaging Het
Lmod2 T A 6: 24,603,377 V117E probably damaging Het
Mapk11 A G 15: 89,144,391 probably null Het
Mcm3 G A 1: 20,805,879 R664C probably damaging Het
Mex3d A G 10: 80,386,936 M162T probably benign Het
Mrgprb3 A G 7: 48,643,023 I260T probably benign Het
Ncor2 G T 5: 125,028,615 A1637D possibly damaging Het
Nedd4 T A 9: 72,730,907 D441E probably damaging Het
Nek5 A T 8: 22,109,912 C194S probably damaging Het
Nos1ap T C 1: 170,318,878 D369G possibly damaging Het
Ntrk1 G T 3: 87,780,084 T681K probably damaging Het
Olfr1306 A G 2: 111,912,181 F250L possibly damaging Het
Olfr538 T C 7: 140,574,470 W106R probably damaging Het
Otogl C T 10: 107,899,461 W154* probably null Het
Pcdh20 T C 14: 88,469,184 T227A possibly damaging Het
Pcdhb17 T C 18: 37,487,271 S705P probably damaging Het
Piezo2 T C 18: 63,124,642 H335R possibly damaging Het
Prkcq G A 2: 11,232,631 V74M probably damaging Het
Prkrip1 A T 5: 136,189,635 probably null Het
Rb1cc1 A G 1: 6,214,680 probably benign Het
Rbm5 A T 9: 107,767,564 Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr3 C A 2: 112,860,460 V1082L probably damaging Het
Sel1l3 C A 5: 53,170,447 E497* probably null Het
Serpina6 A T 12: 103,653,923 I189N probably damaging Het
Serpinb11 A T 1: 107,376,802 T166S probably benign Het
Skint7 T C 4: 111,982,073 L188S probably benign Het
Slc25a45 C T 19: 5,884,930 A269V probably damaging Het
Sltm A G 9: 70,561,800 T114A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spen C A 4: 141,472,950 V2766L probably damaging Het
Srgap2 T A 1: 131,319,537 I445F possibly damaging Het
Stox2 A T 8: 47,194,016 Y200* probably null Het
Strada C A 11: 106,164,184 R384L probably damaging Het
Tctn2 G A 5: 124,619,031 noncoding transcript Het
Tgfbr3l G T 8: 4,249,282 R461L probably benign Het
Tmem65 A G 15: 58,790,149 probably benign Het
Tpst1 G T 5: 130,114,502 V294F possibly damaging Het
Trim23 A G 13: 104,198,618 Y384C probably damaging Het
Ube3b C G 5: 114,404,617 L512V possibly damaging Het
Ubxn4 T A 1: 128,256,179 V92E probably damaging Het
Vmn2r57 A T 7: 41,400,643 C561S probably damaging Het
Vwa8 A G 14: 78,908,195 D104G probably damaging Het
Wdr25 T A 12: 109,026,438 L73* probably null Het
Wnt9a G A 11: 59,330,902 A209T probably benign Het
Zcchc17 A C 4: 130,329,595 C133G probably damaging Het
Zdhhc18 T A 4: 133,608,676 M375L probably benign Het
Zfhx3 T C 8: 108,951,644 F3109L probably benign Het
Zfp202 T A 9: 40,210,466 D286E probably benign Het
Zzef1 T C 11: 72,893,332 L2021P probably benign Het
Other mutations in Pkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Pkn2 APN 3 142799019 missense probably damaging 1.00
IGL00852:Pkn2 APN 3 142809816 unclassified probably benign
IGL00917:Pkn2 APN 3 142853625 missense probably damaging 1.00
IGL01147:Pkn2 APN 3 142829009 missense probably benign 0.06
IGL01556:Pkn2 APN 3 142829317 missense possibly damaging 0.88
IGL01574:Pkn2 APN 3 142839231 missense possibly damaging 0.48
IGL02058:Pkn2 APN 3 142803663 missense probably damaging 0.97
IGL02136:Pkn2 APN 3 142853590 missense probably damaging 1.00
IGL02310:Pkn2 APN 3 142811580 missense probably damaging 1.00
IGL02540:Pkn2 APN 3 142809704 missense probably benign 0.01
IGL02607:Pkn2 APN 3 142794101 critical splice donor site probably null
IGL03256:Pkn2 APN 3 142803550 splice site probably null
voodoo UTSW 3 142853538 missense possibly damaging 0.78
R0001:Pkn2 UTSW 3 142828988 missense probably benign 0.00
R0048:Pkn2 UTSW 3 142810827 missense probably damaging 1.00
R0081:Pkn2 UTSW 3 142853582 missense probably damaging 1.00
R0514:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R0670:Pkn2 UTSW 3 142839343 missense probably damaging 0.99
R0709:Pkn2 UTSW 3 142830520 missense probably damaging 0.98
R1025:Pkn2 UTSW 3 142821565 critical splice donor site probably null
R1190:Pkn2 UTSW 3 142811525 critical splice donor site probably null
R1602:Pkn2 UTSW 3 142853538 missense possibly damaging 0.78
R1729:Pkn2 UTSW 3 142810701 missense probably benign 0.00
R1756:Pkn2 UTSW 3 142810727 missense possibly damaging 0.94
R1797:Pkn2 UTSW 3 142809528 missense probably damaging 1.00
R1833:Pkn2 UTSW 3 142821647 missense probably damaging 1.00
R2035:Pkn2 UTSW 3 142820587 missense probably damaging 0.99
R2058:Pkn2 UTSW 3 142853471 missense possibly damaging 0.93
R3779:Pkn2 UTSW 3 142793980 missense possibly damaging 0.89
R3940:Pkn2 UTSW 3 142793911 missense probably damaging 1.00
R3967:Pkn2 UTSW 3 142809677 missense probably damaging 0.98
R4008:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R4160:Pkn2 UTSW 3 142803564 missense probably benign 0.42
R4222:Pkn2 UTSW 3 142793866 nonsense probably null
R4243:Pkn2 UTSW 3 142820578 missense possibly damaging 0.64
R4380:Pkn2 UTSW 3 142830456 unclassified probably benign
R4826:Pkn2 UTSW 3 142809509 missense probably damaging 1.00
R4869:Pkn2 UTSW 3 142803618 missense probably damaging 1.00
R5096:Pkn2 UTSW 3 142839331 missense probably damaging 0.99
R5175:Pkn2 UTSW 3 142798923 missense probably damaging 1.00
R5301:Pkn2 UTSW 3 142839206 critical splice donor site probably null
R5839:Pkn2 UTSW 3 142821529 missense probably benign 0.02
R6155:Pkn2 UTSW 3 142853693 missense probably benign 0.00
R6198:Pkn2 UTSW 3 142810404 missense probably benign 0.00
R6255:Pkn2 UTSW 3 142811599 missense probably damaging 1.00
R6293:Pkn2 UTSW 3 142809704 missense probably benign 0.15
R6494:Pkn2 UTSW 3 142803668 missense possibly damaging 0.94
R6659:Pkn2 UTSW 3 142803587 missense probably damaging 1.00
R6809:Pkn2 UTSW 3 142799004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTCCTTCCACTTAAGGCAGGC -3'
(R):5'- TGCAGAGGATGTCAAGAAGCACCC -3'

Sequencing Primer
(F):5'- GAAACTGCTTCCAGTGTTCAG -3'
(R):5'- TTCCGGGTAAGTGTAAAAGCTC -3'
Posted On2014-05-23