Incidental Mutation 'R1764:Celsr3'
ID193307
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission 039796-MU
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1764 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108828958 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 880 (E880G)
Ref Sequence ENSEMBL: ENSMUSP00000150759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
Predicted Effect probably damaging
Transcript: ENSMUST00000024238
AA Change: E880G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: E880G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192235
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194742
Predicted Effect probably damaging
Transcript: ENSMUST00000213524
AA Change: E880G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,478,943 I24N possibly damaging Het
4930522L14Rik A G 5: 109,736,789 V401A probably benign Het
5830411N06Rik A G 7: 140,297,265 E831G probably benign Het
9930021J03Rik T A 19: 29,719,160 T978S possibly damaging Het
Abca7 G T 10: 80,008,950 W1502L probably damaging Het
Adcy7 A G 8: 88,308,840 E124G probably benign Het
Aif1l G A 2: 31,965,106 E66K probably benign Het
Aldh8a1 A T 10: 21,395,493 M373L probably benign Het
Alg6 T C 4: 99,741,578 Y131H probably benign Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Arrdc4 A T 7: 68,741,874 I215K probably damaging Het
Asb4 A G 6: 5,390,798 probably null Het
Astn1 T C 1: 158,504,251 I305T probably benign Het
Atp5b T A 10: 128,084,080 probably benign Het
Atp8a1 C A 5: 67,631,567 M1044I probably benign Het
Atp9b C T 18: 80,909,591 probably null Het
Btaf1 A G 19: 36,951,118 H113R probably benign Het
C87436 G T 6: 86,453,612 C338F possibly damaging Het
Casz1 T C 4: 148,942,900 probably benign Het
Cbr3 T A 16: 93,690,482 H184Q probably damaging Het
Cct8l1 T C 5: 25,517,099 S271P possibly damaging Het
Cdc34 A G 10: 79,685,340 K77R probably benign Het
Cdc34 G T 10: 79,685,338 probably null Het
Cdh20 A G 1: 104,934,345 probably benign Het
Cers1 T G 8: 70,321,491 probably null Het
Cntn5 T C 9: 9,673,983 I705V probably benign Het
Dennd4c T A 4: 86,803,010 D636E probably damaging Het
Dnah11 T C 12: 118,190,825 E240G probably benign Het
Dnah2 T C 11: 69,423,543 Y4100C probably damaging Het
Dpysl3 T C 18: 43,363,518 E151G probably damaging Het
Efcab9 T G 11: 32,524,457 T9P possibly damaging Het
Eif4g2 A T 7: 111,074,487 F725Y probably damaging Het
Epha6 T A 16: 59,775,728 I867F probably null Het
Erbin T C 13: 103,843,451 probably benign Het
Evi5l A G 8: 4,203,560 E468G probably damaging Het
Filip1l C T 16: 57,570,038 R330W probably damaging Het
Fmo3 C T 1: 162,958,573 V283M possibly damaging Het
Gabarapl1 A T 6: 129,533,518 K24N possibly damaging Het
Gigyf1 C T 5: 137,522,508 probably benign Het
Gm13089 C A 4: 143,698,270 C201F probably benign Het
Gm5581 T A 6: 131,181,399 noncoding transcript Het
Gon4l G T 3: 88,892,599 K850N probably damaging Het
Igf2bp3 C T 6: 49,109,046 R233H probably damaging Het
Iqcf4 G A 9: 106,568,694 R85C probably benign Het
Kalrn C T 16: 34,212,873 R473Q probably damaging Het
Lmod2 T A 6: 24,603,377 V117E probably damaging Het
Mapk11 A G 15: 89,144,391 probably null Het
Mcm3 G A 1: 20,805,879 R664C probably damaging Het
Mex3d A G 10: 80,386,936 M162T probably benign Het
Mrgprb3 A G 7: 48,643,023 I260T probably benign Het
Ncor2 G T 5: 125,028,615 A1637D possibly damaging Het
Nedd4 T A 9: 72,730,907 D441E probably damaging Het
Nek5 A T 8: 22,109,912 C194S probably damaging Het
Nos1ap T C 1: 170,318,878 D369G possibly damaging Het
Ntrk1 G T 3: 87,780,084 T681K probably damaging Het
Olfr1306 A G 2: 111,912,181 F250L possibly damaging Het
Olfr538 T C 7: 140,574,470 W106R probably damaging Het
Otogl C T 10: 107,899,461 W154* probably null Het
Pcdh20 T C 14: 88,469,184 T227A possibly damaging Het
Pcdhb17 T C 18: 37,487,271 S705P probably damaging Het
Piezo2 T C 18: 63,124,642 H335R possibly damaging Het
Pkn2 T C 3: 142,793,854 Q954R probably damaging Het
Prkcq G A 2: 11,232,631 V74M probably damaging Het
Prkrip1 A T 5: 136,189,635 probably null Het
Rb1cc1 A G 1: 6,214,680 probably benign Het
Rbm5 A T 9: 107,767,564 Y11* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr3 C A 2: 112,860,460 V1082L probably damaging Het
Sel1l3 C A 5: 53,170,447 E497* probably null Het
Serpina6 A T 12: 103,653,923 I189N probably damaging Het
Serpinb11 A T 1: 107,376,802 T166S probably benign Het
Skint7 T C 4: 111,982,073 L188S probably benign Het
Slc25a45 C T 19: 5,884,930 A269V probably damaging Het
Sltm A G 9: 70,561,800 T114A probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spen C A 4: 141,472,950 V2766L probably damaging Het
Srgap2 T A 1: 131,319,537 I445F possibly damaging Het
Stox2 A T 8: 47,194,016 Y200* probably null Het
Strada C A 11: 106,164,184 R384L probably damaging Het
Tctn2 G A 5: 124,619,031 noncoding transcript Het
Tgfbr3l G T 8: 4,249,282 R461L probably benign Het
Tmem65 A G 15: 58,790,149 probably benign Het
Tpst1 G T 5: 130,114,502 V294F possibly damaging Het
Trim23 A G 13: 104,198,618 Y384C probably damaging Het
Ube3b C G 5: 114,404,617 L512V possibly damaging Het
Ubxn4 T A 1: 128,256,179 V92E probably damaging Het
Vmn2r57 A T 7: 41,400,643 C561S probably damaging Het
Vwa8 A G 14: 78,908,195 D104G probably damaging Het
Wdr25 T A 12: 109,026,438 L73* probably null Het
Wnt9a G A 11: 59,330,902 A209T probably benign Het
Zcchc17 A C 4: 130,329,595 C133G probably damaging Het
Zdhhc18 T A 4: 133,608,676 M375L probably benign Het
Zfhx3 T C 8: 108,951,644 F3109L probably benign Het
Zfp202 T A 9: 40,210,466 D286E probably benign Het
Zzef1 T C 11: 72,893,332 L2021P probably benign Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGGATTACAAGCAGGAACGCTAC -3'
(R):5'- GGCCACAAACTGAGGAGCATTGTC -3'

Sequencing Primer
(F):5'- AGGAACGCTACTTCAAGCTG -3'
(R):5'- CTGAGGAGCATTGTCATTCAC -3'
Posted On2014-05-23