Incidental Mutation 'R1750:Inpp5d'
ID193344
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission 039782-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1750 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87699081 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 540 (F540L)
Ref Sequence ENSEMBL: ENSMUSP00000127941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect probably damaging
Transcript: ENSMUST00000042275
AA Change: F539L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: F539L

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072999
AA Change: F539L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: F539L

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167032
AA Change: F277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: F277L

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168783
AA Change: F540L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: F540L

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169754
AA Change: F540L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: F540L

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170300
AA Change: F277L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: F277L

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik G T 7: 131,146,130 N44K probably benign Het
Acd C A 8: 105,698,892 A270S possibly damaging Het
Acnat1 G A 4: 49,451,042 T23I probably benign Het
Adam26a T G 8: 43,570,189 E88A possibly damaging Het
Adgrb1 G A 15: 74,541,827 V589M probably benign Het
Agbl2 T A 2: 90,816,376 probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Asap2 T C 12: 21,203,998 L170P probably damaging Het
Btg2 T C 1: 134,079,031 D8G probably benign Het
C530008M17Rik A G 5: 76,857,675 I628V unknown Het
Cacna1g A T 11: 94,443,292 V841E probably damaging Het
Cacna2d1 C T 5: 16,264,288 P230L probably benign Het
Cacna2d2 A T 9: 107,524,644 D766V probably damaging Het
Carns1 A G 19: 4,173,157 W23R possibly damaging Het
Cdk11b T A 4: 155,628,680 probably null Het
Chrna3 T C 9: 55,016,057 S156G probably damaging Het
Cmya5 A T 13: 93,095,663 N972K probably benign Het
Cpne7 C A 8: 123,134,524 P541T probably damaging Het
Csmd1 A T 8: 15,917,303 L3187I probably damaging Het
Dbt A G 3: 116,546,294 I404V probably benign Het
Dgki A T 6: 36,916,434 I819K probably damaging Het
Dip2b T A 15: 100,178,466 S782T probably benign Het
Dlc1 A T 8: 36,858,090 probably null Het
Dnajc13 A T 9: 104,221,477 V459E probably damaging Het
Enam A G 5: 88,503,227 E790G probably damaging Het
Epb41l4a G C 18: 33,828,208 Y424* probably null Het
Extl1 A G 4: 134,362,688 S370P probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fbxw25 A T 9: 109,650,073 I370N probably benign Het
Fcgbp T A 7: 28,093,443 Y957* probably null Het
Gkap1 C A 13: 58,237,043 E77* probably null Het
Gkn1 A T 6: 87,349,123 N28K unknown Het
Gls2 A G 10: 128,201,325 E245G probably damaging Het
Glyat G A 19: 12,646,315 V32I probably benign Het
Gm2431 A T 7: 142,258,025 C47* probably null Het
Gm5431 T C 11: 48,894,831 D239G probably benign Het
Gm9573 T A 17: 35,621,048 probably benign Het
Kcna1 A C 6: 126,642,808 I183S probably benign Het
Kpna2 G T 11: 106,991,445 L212I probably damaging Het
Krt36 C G 11: 100,104,058 R229S probably benign Het
Krt78 G A 15: 101,946,377 H1000Y probably benign Het
Krt90 A G 15: 101,553,365 probably benign Het
Ldlrad4 C A 18: 68,106,687 F59L probably benign Het
Lrrc3b T C 14: 15,358,601 N2D probably benign Het
Madd T C 2: 91,167,891 D239G probably damaging Het
Mapk8ip3 C T 17: 24,914,459 G332S probably null Het
Mastl A T 2: 23,146,081 L141* probably null Het
Mdh1b T C 1: 63,719,522 N304D probably benign Het
Mfsd4b3 G T 10: 39,947,933 N110K probably benign Het
Mtus2 T C 5: 148,277,633 S1035P probably damaging Het
Myh11 T A 16: 14,200,758 D1908V probably damaging Het
Myh11 T C 16: 14,215,790 E1080G probably damaging Het
Mypn A C 10: 63,136,197 M688R probably benign Het
Nat8l G T 5: 34,000,786 C180F probably damaging Het
Nip7 T A 8: 107,057,386 L86Q probably damaging Het
Nisch C T 14: 31,174,882 probably benign Het
Nop2 A G 6: 125,137,638 I283V probably benign Het
Oas1h T A 5: 120,871,777 probably null Het
Olfr1118 T C 2: 87,308,852 V41A probably benign Het
Olfr1141 T A 2: 87,753,186 D269V probably damaging Het
Olfr117 A C 17: 37,659,673 I220S probably damaging Het
Olfr1188 C A 2: 88,560,058 D185E possibly damaging Het
Olfr1199 T C 2: 88,755,773 R301G probably benign Het
Olfr504 A T 7: 108,565,357 L146* probably null Het
Olfr901 T A 9: 38,430,690 M136K probably damaging Het
P4hb A G 11: 120,562,720 V373A probably damaging Het
Pappa2 C A 1: 158,763,150 E1645* probably null Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb17 C T 18: 37,485,711 R185C probably damaging Het
Pcdhb17 A G 18: 37,487,017 H620R possibly damaging Het
Pdcl3 T A 1: 38,995,865 F168I probably damaging Het
Pde4a T A 9: 21,203,232 I365N probably damaging Het
Pdzd2 A G 15: 12,385,864 V940A probably damaging Het
Picalm T A 7: 90,191,182 S399T possibly damaging Het
Pigk A T 3: 152,744,464 I249F probably damaging Het
Plxnb1 C A 9: 109,111,768 H1570Q probably benign Het
Plxnc1 A G 10: 94,799,497 Y1321H probably damaging Het
Ppm1g G A 5: 31,206,216 S114F probably damaging Het
Rassf4 A G 6: 116,640,267 M259T probably damaging Het
Rbm47 T C 5: 66,019,310 K557E possibly damaging Het
Rhobtb1 A G 10: 69,279,406 K21R probably damaging Het
Selenoi T C 5: 30,257,773 F212S probably benign Het
Shc3 T G 13: 51,449,292 Y259S probably damaging Het
Slc11a2 T C 15: 100,401,287 N134S probably damaging Het
Slc9a7 A T X: 20,162,478 M368K probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Spata31d1d T A 13: 59,728,695 Q342L probably benign Het
Spink13 T A 18: 62,607,749 Y93F probably damaging Het
St6galnac5 A T 3: 152,846,321 I203N possibly damaging Het
Syne2 T A 12: 76,052,805 C5335S probably damaging Het
Tagap T A 17: 7,929,910 D173E probably benign Het
Tekt3 A C 11: 63,070,041 Y12S probably damaging Het
Tmem81 T A 1: 132,507,583 N42K probably damaging Het
Tnc A G 4: 63,972,735 W1728R probably damaging Het
Ttc30a1 C T 2: 75,980,255 V495I probably benign Het
Ttc33 C T 15: 5,212,098 R135* probably null Het
Ttc37 T A 13: 76,140,601 L951Q possibly damaging Het
Unc5c A G 3: 141,827,517 D842G possibly damaging Het
Usp43 A T 11: 67,879,953 H618Q probably damaging Het
Vmn2r50 T G 7: 10,052,988 N64T possibly damaging Het
Vmn2r53 T C 7: 12,581,705 Y729C probably damaging Het
Vmn2r59 T A 7: 42,045,827 H387L possibly damaging Het
Vstm2a G T 11: 16,263,166 V184F possibly damaging Het
Wdr53 T G 16: 32,252,117 N93K probably damaging Het
Wdr95 A G 5: 149,581,886 probably null Het
Xpot A T 10: 121,603,027 probably null Het
Xrcc5 C T 1: 72,325,087 Q233* probably null Het
Zbtb18 T A 1: 177,447,511 C137S possibly damaging Het
Zfp58 C A 13: 67,491,479 G298* probably null Het
Zfp963 A G 8: 69,743,450 S118P possibly damaging Het
Zmynd15 A T 11: 70,462,567 Q336L probably benign Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6885:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTAGAAAATCACAAGGCTGCTACCAC -3'
(R):5'- TCTGGGAAACCCAACTGGGAACAC -3'

Sequencing Primer
(F):5'- GCTACCACCTGCCAGTC -3'
(R):5'- ATGCAGGAATCTACCCATTAGG -3'
Posted On2014-05-23