Incidental Mutation 'R1750:Dgki'
ID193385
Institutional Source Beutler Lab
Gene Symbol Dgki
Ensembl Gene ENSMUSG00000038665
Gene Namediacylglycerol kinase, iota
SynonymsC130010K08Rik
MMRRC Submission 039782-MU
Accession Numbers

Genbank: NM_001081206.1

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1750 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location36846022-37300184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36916434 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 819 (I819K)
Ref Sequence ENSEMBL: ENSMUSP00000138628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042075] [ENSMUST00000090314] [ENSMUST00000101532] [ENSMUST00000138286] [ENSMUST00000150300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042075
AA Change: I668K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047858
Gene: ENSMUSG00000038665
AA Change: I668K

DomainStartEndE-ValueType
C1 22 76 3.67e-1 SMART
C1 95 153 5.92e-4 SMART
DAGKc 220 344 6.73e-58 SMART
DAGKa 370 527 2.29e-92 SMART
ANK 792 822 5.53e-3 SMART
ANK 828 857 2.07e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090314
AA Change: I819K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087788
Gene: ENSMUSG00000038665
AA Change: I819K

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 943 973 5.53e-3 SMART
ANK 979 1008 2.07e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101532
AA Change: I840K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099071
Gene: ENSMUSG00000038665
AA Change: I840K

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 678 2.29e-92 SMART
ANK 964 994 5.53e-3 SMART
ANK 1000 1029 2.07e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138286
AA Change: I819K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138628
Gene: ENSMUSG00000038665
AA Change: I819K

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 1.8e-3 SMART
C1 246 304 2.9e-6 SMART
DAGKc 371 495 3.2e-60 SMART
DAGKa 521 678 1.1e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143046
Predicted Effect probably benign
Transcript: ENSMUST00000150300
SMART Domains Protein: ENSMUSP00000138457
Gene: ENSMUSG00000038665

DomainStartEndE-ValueType
low complexity region 10 34 N/A INTRINSIC
low complexity region 36 50 N/A INTRINSIC
low complexity region 54 116 N/A INTRINSIC
C1 173 227 3.67e-1 SMART
C1 246 304 5.92e-4 SMART
DAGKc 371 495 6.73e-58 SMART
DAGKa 521 591 1.43e-6 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV diacylglycerol kinase subfamily. Diacylglycerol kinases regulate the intracellular concentration of diacylglycerol through its phosphorylation, producing phosphatidic acid. The specific role of the enzyme encoded by this gene is undetermined, however, it may play a crucial role in the production of phosphatidic acid in the retina or in recessive forms of retinal degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are grossly normal and do not develop tumors when wounded or when exposed to phorbol ester. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik G T 7: 131,146,130 N44K probably benign Het
Acd C A 8: 105,698,892 A270S possibly damaging Het
Acnat1 G A 4: 49,451,042 T23I probably benign Het
Adam26a T G 8: 43,570,189 E88A possibly damaging Het
Adgrb1 G A 15: 74,541,827 V589M probably benign Het
Agbl2 T A 2: 90,816,376 probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Asap2 T C 12: 21,203,998 L170P probably damaging Het
Btg2 T C 1: 134,079,031 D8G probably benign Het
C530008M17Rik A G 5: 76,857,675 I628V unknown Het
Cacna1g A T 11: 94,443,292 V841E probably damaging Het
Cacna2d1 C T 5: 16,264,288 P230L probably benign Het
Cacna2d2 A T 9: 107,524,644 D766V probably damaging Het
Carns1 A G 19: 4,173,157 W23R possibly damaging Het
Cdk11b T A 4: 155,628,680 probably null Het
Chrna3 T C 9: 55,016,057 S156G probably damaging Het
Cmya5 A T 13: 93,095,663 N972K probably benign Het
Cpne7 C A 8: 123,134,524 P541T probably damaging Het
Csmd1 A T 8: 15,917,303 L3187I probably damaging Het
Dbt A G 3: 116,546,294 I404V probably benign Het
Dip2b T A 15: 100,178,466 S782T probably benign Het
Dlc1 A T 8: 36,858,090 probably null Het
Dnajc13 A T 9: 104,221,477 V459E probably damaging Het
Enam A G 5: 88,503,227 E790G probably damaging Het
Epb41l4a G C 18: 33,828,208 Y424* probably null Het
Extl1 A G 4: 134,362,688 S370P probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fbxw25 A T 9: 109,650,073 I370N probably benign Het
Fcgbp T A 7: 28,093,443 Y957* probably null Het
Gkap1 C A 13: 58,237,043 E77* probably null Het
Gkn1 A T 6: 87,349,123 N28K unknown Het
Gls2 A G 10: 128,201,325 E245G probably damaging Het
Glyat G A 19: 12,646,315 V32I probably benign Het
Gm2431 A T 7: 142,258,025 C47* probably null Het
Gm5431 T C 11: 48,894,831 D239G probably benign Het
Gm9573 T A 17: 35,621,048 probably benign Het
Inpp5d T C 1: 87,699,081 F540L probably damaging Het
Kcna1 A C 6: 126,642,808 I183S probably benign Het
Kpna2 G T 11: 106,991,445 L212I probably damaging Het
Krt36 C G 11: 100,104,058 R229S probably benign Het
Krt78 G A 15: 101,946,377 H1000Y probably benign Het
Krt90 A G 15: 101,553,365 probably benign Het
Ldlrad4 C A 18: 68,106,687 F59L probably benign Het
Lrrc3b T C 14: 15,358,601 N2D probably benign Het
Madd T C 2: 91,167,891 D239G probably damaging Het
Mapk8ip3 C T 17: 24,914,459 G332S probably null Het
Mastl A T 2: 23,146,081 L141* probably null Het
Mdh1b T C 1: 63,719,522 N304D probably benign Het
Mfsd4b3 G T 10: 39,947,933 N110K probably benign Het
Mtus2 T C 5: 148,277,633 S1035P probably damaging Het
Myh11 T A 16: 14,200,758 D1908V probably damaging Het
Myh11 T C 16: 14,215,790 E1080G probably damaging Het
Mypn A C 10: 63,136,197 M688R probably benign Het
Nat8l G T 5: 34,000,786 C180F probably damaging Het
Nip7 T A 8: 107,057,386 L86Q probably damaging Het
Nisch C T 14: 31,174,882 probably benign Het
Nop2 A G 6: 125,137,638 I283V probably benign Het
Oas1h T A 5: 120,871,777 probably null Het
Olfr1118 T C 2: 87,308,852 V41A probably benign Het
Olfr1141 T A 2: 87,753,186 D269V probably damaging Het
Olfr117 A C 17: 37,659,673 I220S probably damaging Het
Olfr1188 C A 2: 88,560,058 D185E possibly damaging Het
Olfr1199 T C 2: 88,755,773 R301G probably benign Het
Olfr504 A T 7: 108,565,357 L146* probably null Het
Olfr901 T A 9: 38,430,690 M136K probably damaging Het
P4hb A G 11: 120,562,720 V373A probably damaging Het
Pappa2 C A 1: 158,763,150 E1645* probably null Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb17 C T 18: 37,485,711 R185C probably damaging Het
Pcdhb17 A G 18: 37,487,017 H620R possibly damaging Het
Pdcl3 T A 1: 38,995,865 F168I probably damaging Het
Pde4a T A 9: 21,203,232 I365N probably damaging Het
Pdzd2 A G 15: 12,385,864 V940A probably damaging Het
Picalm T A 7: 90,191,182 S399T possibly damaging Het
Pigk A T 3: 152,744,464 I249F probably damaging Het
Plxnb1 C A 9: 109,111,768 H1570Q probably benign Het
Plxnc1 A G 10: 94,799,497 Y1321H probably damaging Het
Ppm1g G A 5: 31,206,216 S114F probably damaging Het
Rassf4 A G 6: 116,640,267 M259T probably damaging Het
Rbm47 T C 5: 66,019,310 K557E possibly damaging Het
Rhobtb1 A G 10: 69,279,406 K21R probably damaging Het
Selenoi T C 5: 30,257,773 F212S probably benign Het
Shc3 T G 13: 51,449,292 Y259S probably damaging Het
Slc11a2 T C 15: 100,401,287 N134S probably damaging Het
Slc9a7 A T X: 20,162,478 M368K probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Spata31d1d T A 13: 59,728,695 Q342L probably benign Het
Spink13 T A 18: 62,607,749 Y93F probably damaging Het
St6galnac5 A T 3: 152,846,321 I203N possibly damaging Het
Syne2 T A 12: 76,052,805 C5335S probably damaging Het
Tagap T A 17: 7,929,910 D173E probably benign Het
Tekt3 A C 11: 63,070,041 Y12S probably damaging Het
Tmem81 T A 1: 132,507,583 N42K probably damaging Het
Tnc A G 4: 63,972,735 W1728R probably damaging Het
Ttc30a1 C T 2: 75,980,255 V495I probably benign Het
Ttc33 C T 15: 5,212,098 R135* probably null Het
Ttc37 T A 13: 76,140,601 L951Q possibly damaging Het
Unc5c A G 3: 141,827,517 D842G possibly damaging Het
Usp43 A T 11: 67,879,953 H618Q probably damaging Het
Vmn2r50 T G 7: 10,052,988 N64T possibly damaging Het
Vmn2r53 T C 7: 12,581,705 Y729C probably damaging Het
Vmn2r59 T A 7: 42,045,827 H387L possibly damaging Het
Vstm2a G T 11: 16,263,166 V184F possibly damaging Het
Wdr53 T G 16: 32,252,117 N93K probably damaging Het
Wdr95 A G 5: 149,581,886 probably null Het
Xpot A T 10: 121,603,027 probably null Het
Xrcc5 C T 1: 72,325,087 Q233* probably null Het
Zbtb18 T A 1: 177,447,511 C137S possibly damaging Het
Zfp58 C A 13: 67,491,479 G298* probably null Het
Zfp963 A G 8: 69,743,450 S118P possibly damaging Het
Zmynd15 A T 11: 70,462,567 Q336L probably benign Het
Other mutations in Dgki
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dgki APN 6 36862456 missense probably benign 0.00
IGL00951:Dgki APN 6 37000159 missense probably damaging 0.97
IGL01087:Dgki APN 6 37012911 missense probably damaging 1.00
IGL01396:Dgki APN 6 37000090 missense probably damaging 1.00
IGL02113:Dgki APN 6 36913625 splice site probably benign
IGL02174:Dgki APN 6 37032921 missense probably damaging 1.00
IGL02215:Dgki APN 6 37016675 missense probably damaging 1.00
IGL02353:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02360:Dgki APN 6 36847389 missense probably damaging 1.00
IGL02662:Dgki APN 6 36862486 splice site probably benign
IGL02891:Dgki APN 6 36913741 missense probably benign 0.15
IGL03040:Dgki APN 6 37149664 splice site probably benign
IGL03064:Dgki APN 6 37149664 splice site probably benign
IGL03283:Dgki APN 6 36937311 splice site probably benign
IGL03349:Dgki APN 6 37097627 critical splice acceptor site probably null
H8477:Dgki UTSW 6 37029851 splice site probably benign
R0392:Dgki UTSW 6 37000178 missense probably damaging 1.00
R0630:Dgki UTSW 6 37000198 missense probably damaging 1.00
R0718:Dgki UTSW 6 37012896 missense probably damaging 1.00
R1420:Dgki UTSW 6 37050269 intron probably null
R1546:Dgki UTSW 6 37050203 missense probably damaging 1.00
R1634:Dgki UTSW 6 36915490 missense probably benign
R1639:Dgki UTSW 6 36937364 missense probably damaging 1.00
R1738:Dgki UTSW 6 37057432 missense possibly damaging 0.93
R1808:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R1834:Dgki UTSW 6 37034701 splice site probably benign
R2001:Dgki UTSW 6 36865801 missense possibly damaging 0.94
R2047:Dgki UTSW 6 36913646 missense possibly damaging 0.69
R2413:Dgki UTSW 6 36847473 missense possibly damaging 0.49
R3034:Dgki UTSW 6 37087670 missense probably damaging 1.00
R4493:Dgki UTSW 6 36974861 intron probably benign
R4684:Dgki UTSW 6 37299846 unclassified probably benign
R4727:Dgki UTSW 6 37299813 unclassified probably benign
R5104:Dgki UTSW 6 37149574 missense possibly damaging 0.84
R5756:Dgki UTSW 6 36937058 intron probably benign
R6946:Dgki UTSW 6 37299636 nonsense probably null
X0066:Dgki UTSW 6 37063997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAGACTTCTGCCCCACAATG -3'
(R):5'- ATTTAGAGGCTGCCCACCCATGTC -3'

Sequencing Primer
(F):5'- cacacacacacacacacacac -3'
(R):5'- GCCCACCCATGTCATATGC -3'
Posted On2014-05-23