Incidental Mutation 'R1750:Plxnb1'
ID193417
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission 039782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1750 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109111768 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1570 (H1570Q)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably benign
Transcript: ENSMUST00000072093
AA Change: H1570Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: H1570Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192117
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195364
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik G T 7: 131,146,130 N44K probably benign Het
Acd C A 8: 105,698,892 A270S possibly damaging Het
Acnat1 G A 4: 49,451,042 T23I probably benign Het
Adam26a T G 8: 43,570,189 E88A possibly damaging Het
Adgrb1 G A 15: 74,541,827 V589M probably benign Het
Agbl2 T A 2: 90,816,376 probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Asap2 T C 12: 21,203,998 L170P probably damaging Het
Btg2 T C 1: 134,079,031 D8G probably benign Het
C530008M17Rik A G 5: 76,857,675 I628V unknown Het
Cacna1g A T 11: 94,443,292 V841E probably damaging Het
Cacna2d1 C T 5: 16,264,288 P230L probably benign Het
Cacna2d2 A T 9: 107,524,644 D766V probably damaging Het
Carns1 A G 19: 4,173,157 W23R possibly damaging Het
Cdk11b T A 4: 155,628,680 probably null Het
Chrna3 T C 9: 55,016,057 S156G probably damaging Het
Cmya5 A T 13: 93,095,663 N972K probably benign Het
Cpne7 C A 8: 123,134,524 P541T probably damaging Het
Csmd1 A T 8: 15,917,303 L3187I probably damaging Het
Dbt A G 3: 116,546,294 I404V probably benign Het
Dgki A T 6: 36,916,434 I819K probably damaging Het
Dip2b T A 15: 100,178,466 S782T probably benign Het
Dlc1 A T 8: 36,858,090 probably null Het
Dnajc13 A T 9: 104,221,477 V459E probably damaging Het
Enam A G 5: 88,503,227 E790G probably damaging Het
Epb41l4a G C 18: 33,828,208 Y424* probably null Het
Extl1 A G 4: 134,362,688 S370P probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fbxw25 A T 9: 109,650,073 I370N probably benign Het
Fcgbp T A 7: 28,093,443 Y957* probably null Het
Gkap1 C A 13: 58,237,043 E77* probably null Het
Gkn1 A T 6: 87,349,123 N28K unknown Het
Gls2 A G 10: 128,201,325 E245G probably damaging Het
Glyat G A 19: 12,646,315 V32I probably benign Het
Gm2431 A T 7: 142,258,025 C47* probably null Het
Gm5431 T C 11: 48,894,831 D239G probably benign Het
Gm9573 T A 17: 35,621,048 probably benign Het
Inpp5d T C 1: 87,699,081 F540L probably damaging Het
Kcna1 A C 6: 126,642,808 I183S probably benign Het
Kpna2 G T 11: 106,991,445 L212I probably damaging Het
Krt36 C G 11: 100,104,058 R229S probably benign Het
Krt78 G A 15: 101,946,377 H1000Y probably benign Het
Krt90 A G 15: 101,553,365 probably benign Het
Ldlrad4 C A 18: 68,106,687 F59L probably benign Het
Lrrc3b T C 14: 15,358,601 N2D probably benign Het
Madd T C 2: 91,167,891 D239G probably damaging Het
Mapk8ip3 C T 17: 24,914,459 G332S probably null Het
Mastl A T 2: 23,146,081 L141* probably null Het
Mdh1b T C 1: 63,719,522 N304D probably benign Het
Mfsd4b3 G T 10: 39,947,933 N110K probably benign Het
Mtus2 T C 5: 148,277,633 S1035P probably damaging Het
Myh11 T A 16: 14,200,758 D1908V probably damaging Het
Myh11 T C 16: 14,215,790 E1080G probably damaging Het
Mypn A C 10: 63,136,197 M688R probably benign Het
Nat8l G T 5: 34,000,786 C180F probably damaging Het
Nip7 T A 8: 107,057,386 L86Q probably damaging Het
Nisch C T 14: 31,174,882 probably benign Het
Nop2 A G 6: 125,137,638 I283V probably benign Het
Oas1h T A 5: 120,871,777 probably null Het
Olfr1118 T C 2: 87,308,852 V41A probably benign Het
Olfr1141 T A 2: 87,753,186 D269V probably damaging Het
Olfr117 A C 17: 37,659,673 I220S probably damaging Het
Olfr1188 C A 2: 88,560,058 D185E possibly damaging Het
Olfr1199 T C 2: 88,755,773 R301G probably benign Het
Olfr504 A T 7: 108,565,357 L146* probably null Het
Olfr901 T A 9: 38,430,690 M136K probably damaging Het
P4hb A G 11: 120,562,720 V373A probably damaging Het
Pappa2 C A 1: 158,763,150 E1645* probably null Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb17 C T 18: 37,485,711 R185C probably damaging Het
Pcdhb17 A G 18: 37,487,017 H620R possibly damaging Het
Pdcl3 T A 1: 38,995,865 F168I probably damaging Het
Pde4a T A 9: 21,203,232 I365N probably damaging Het
Pdzd2 A G 15: 12,385,864 V940A probably damaging Het
Picalm T A 7: 90,191,182 S399T possibly damaging Het
Pigk A T 3: 152,744,464 I249F probably damaging Het
Plxnc1 A G 10: 94,799,497 Y1321H probably damaging Het
Ppm1g G A 5: 31,206,216 S114F probably damaging Het
Rassf4 A G 6: 116,640,267 M259T probably damaging Het
Rbm47 T C 5: 66,019,310 K557E possibly damaging Het
Rhobtb1 A G 10: 69,279,406 K21R probably damaging Het
Selenoi T C 5: 30,257,773 F212S probably benign Het
Shc3 T G 13: 51,449,292 Y259S probably damaging Het
Slc11a2 T C 15: 100,401,287 N134S probably damaging Het
Slc9a7 A T X: 20,162,478 M368K probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Spata31d1d T A 13: 59,728,695 Q342L probably benign Het
Spink13 T A 18: 62,607,749 Y93F probably damaging Het
St6galnac5 A T 3: 152,846,321 I203N possibly damaging Het
Syne2 T A 12: 76,052,805 C5335S probably damaging Het
Tagap T A 17: 7,929,910 D173E probably benign Het
Tekt3 A C 11: 63,070,041 Y12S probably damaging Het
Tmem81 T A 1: 132,507,583 N42K probably damaging Het
Tnc A G 4: 63,972,735 W1728R probably damaging Het
Ttc30a1 C T 2: 75,980,255 V495I probably benign Het
Ttc33 C T 15: 5,212,098 R135* probably null Het
Ttc37 T A 13: 76,140,601 L951Q possibly damaging Het
Unc5c A G 3: 141,827,517 D842G possibly damaging Het
Usp43 A T 11: 67,879,953 H618Q probably damaging Het
Vmn2r50 T G 7: 10,052,988 N64T possibly damaging Het
Vmn2r53 T C 7: 12,581,705 Y729C probably damaging Het
Vmn2r59 T A 7: 42,045,827 H387L possibly damaging Het
Vstm2a G T 11: 16,263,166 V184F possibly damaging Het
Wdr53 T G 16: 32,252,117 N93K probably damaging Het
Wdr95 A G 5: 149,581,886 probably null Het
Xpot A T 10: 121,603,027 probably null Het
Xrcc5 C T 1: 72,325,087 Q233* probably null Het
Zbtb18 T A 1: 177,447,511 C137S possibly damaging Het
Zfp58 C A 13: 67,491,479 G298* probably null Het
Zfp963 A G 8: 69,743,450 S118P possibly damaging Het
Zmynd15 A T 11: 70,462,567 Q336L probably benign Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGAGCCTAGCAAGGGCTTTGG -3'
(R):5'- TCCCGTGAAGTGCAACAGTGAG -3'

Sequencing Primer
(F):5'- TGTACGGGACCGCTGTAAG -3'
(R):5'- ACTCTCCAGTGTGTGGATGAAC -3'
Posted On2014-05-23