Incidental Mutation 'R0017:Reg3b'
ID19345
Institutional Source Beutler Lab
Gene Symbol Reg3b
Ensembl Gene ENSMUSG00000071356
Gene Nameregenerating islet-derived 3 beta
SynonymsPap, PAP1, REG-III, RegIII (beta)
MMRRC Submission 038312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0017 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location78370657-78373466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78372861 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 128 (M128K)
Ref Sequence ENSEMBL: ENSMUSP00000145528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089667] [ENSMUST00000096904] [ENSMUST00000167492] [ENSMUST00000203266] [ENSMUST00000204873] [ENSMUST00000205240]
Predicted Effect probably benign
Transcript: ENSMUST00000089667
SMART Domains Protein: ENSMUSP00000087096
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096904
AA Change: M128K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000094667
Gene: ENSMUSG00000071356
AA Change: M128K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167492
SMART Domains Protein: ENSMUSP00000132220
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203266
AA Change: M128K

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145528
Gene: ENSMUSG00000071356
AA Change: M128K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 143 5e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204760
Predicted Effect probably benign
Transcript: ENSMUST00000204873
AA Change: M128K

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145280
Gene: ENSMUSG00000071356
AA Change: M128K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 140 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205240
SMART Domains Protein: ENSMUSP00000144715
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It has similarity to the C-type lectin superfamily. The enhanced expression of this gene is observed during pancreatic inflammation and liver carcinogenesis. The mature protein also functions as an antimicrobial protein with antibacterial activity. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Nov 2014]
PHENOTYPE: Male homozygous mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,008,106 probably benign Het
Abca13 T A 11: 9,292,775 I1546N probably damaging Het
Actrt3 A T 3: 30,598,273 M224K probably benign Het
Adgrv1 T C 13: 81,578,946 N429S probably benign Het
Appbp2 A C 11: 85,214,303 C146G possibly damaging Het
Cabp2 A C 19: 4,086,242 D83A possibly damaging Het
Ccl1 A G 11: 82,178,017 probably null Het
Cdca8 T C 4: 124,920,375 T208A probably benign Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dcdc5 G A 2: 106,357,196 noncoding transcript Het
Efr3b C A 12: 3,993,003 C89F probably damaging Het
Enpp3 C T 10: 24,799,153 probably null Het
Ep400 A T 5: 110,673,529 V2467E probably damaging Het
Ermap T C 4: 119,179,948 probably benign Het
Fig4 A G 10: 41,273,007 Y150H possibly damaging Het
Fsip2 G A 2: 82,992,072 V6050M probably damaging Het
Gm11397 A C 13: 33,404,511 I360L probably damaging Het
Gnb1l T C 16: 18,541,060 W72R probably damaging Het
Gpld1 A G 13: 24,990,118 D842G probably damaging Het
Hmgcr A G 13: 96,652,089 probably benign Het
Hrc A G 7: 45,336,370 H315R possibly damaging Het
Ifit2 A T 19: 34,573,573 N171I probably damaging Het
Ipo11 T A 13: 106,886,730 I416L probably benign Het
Kcnab1 G A 3: 65,357,106 V259M probably damaging Het
Kcng4 T C 8: 119,633,520 Y39C probably damaging Het
Kif5c A G 2: 49,732,713 T526A probably benign Het
Kntc1 A G 5: 123,780,981 Y805C probably damaging Het
Mal A G 2: 127,640,307 S59P probably damaging Het
Myh15 A G 16: 49,163,060 N1513D probably damaging Het
Ncoa2 A G 1: 13,174,752 L574P probably damaging Het
Nmd3 A G 3: 69,736,092 probably null Het
Nucb2 A G 7: 116,533,151 D331G probably benign Het
Nwd1 T C 8: 72,709,425 probably benign Het
Nynrin T C 14: 55,872,395 F1653S probably damaging Het
Olfr1253 A C 2: 89,752,021 I269S possibly damaging Het
Olfr371 T A 8: 85,231,077 I194N probably benign Het
Olfr875 T G 9: 37,772,978 F106L probably benign Het
Pfdn6 T C 17: 33,939,564 R79G probably damaging Het
Pkd1 G T 17: 24,578,539 probably null Het
Pramel4 T G 4: 144,068,344 C434G probably benign Het
Ptpn13 T C 5: 103,486,772 probably null Het
Ptpro T C 6: 137,416,827 V831A probably benign Het
Rabl6 A T 2: 25,602,567 probably benign Het
Rif1 A G 2: 52,116,674 T2207A probably benign Het
Rpa1 A C 11: 75,314,861 N223K probably null Het
Rras2 T C 7: 114,048,255 probably benign Het
Ryr1 T A 7: 29,047,542 E3760V probably damaging Het
Scyl3 T A 1: 163,939,969 I204N possibly damaging Het
Slc16a12 A G 19: 34,672,698 probably benign Het
Slc22a1 A G 17: 12,659,759 F356L probably damaging Het
Slc22a29 A G 19: 8,218,266 probably benign Het
Slc45a1 C A 4: 150,629,566 D741Y possibly damaging Het
Slco1a5 A T 6: 142,236,335 probably benign Het
Smg5 G T 3: 88,351,105 R461L probably damaging Het
Snrk T C 9: 122,166,240 S362P probably damaging Het
Spata31d1b A G 13: 59,716,069 S344G probably benign Het
Sync G A 4: 129,293,744 V190M probably damaging Het
Taf5l T C 8: 124,003,644 Y67C probably damaging Het
Tbkbp1 A G 11: 97,146,289 probably benign Het
Tshr A T 12: 91,537,886 I533F possibly damaging Het
Tsn T C 1: 118,300,859 D211G probably damaging Het
Ttn G A 2: 76,791,644 T15518I probably benign Het
Unc13c T C 9: 73,693,301 D1387G probably benign Het
Vapb A G 2: 173,771,604 T99A probably benign Het
Vmn2r-ps119 A G 17: 19,153,617 noncoding transcript Het
Zfp280d A T 9: 72,339,010 probably null Het
Other mutations in Reg3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Reg3b APN 6 78372200 nonsense probably null
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0413:Reg3b UTSW 6 78371841 missense probably damaging 1.00
R1321:Reg3b UTSW 6 78372953 unclassified probably null
R1794:Reg3b UTSW 6 78372214 unclassified probably null
R1960:Reg3b UTSW 6 78371814 missense probably damaging 0.98
R2513:Reg3b UTSW 6 78371819 missense probably benign 0.00
R3877:Reg3b UTSW 6 78371233 missense possibly damaging 0.65
R4033:Reg3b UTSW 6 78373209 missense possibly damaging 0.71
R4874:Reg3b UTSW 6 78372826 missense possibly damaging 0.53
R5118:Reg3b UTSW 6 78372128 missense probably damaging 1.00
R5301:Reg3b UTSW 6 78371260 missense probably damaging 0.96
R5344:Reg3b UTSW 6 78372860 missense probably benign 0.02
R5408:Reg3b UTSW 6 78373232 missense probably benign
R5824:Reg3b UTSW 6 78372121 missense possibly damaging 0.83
R6643:Reg3b UTSW 6 78372922 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATGATCACCCAAGTTCTGGGAGGC -3'
(R):5'- TGCAGACATAGGGCAACTTCACC -3'

Sequencing Primer
(F):5'- AGTTCTGGGAGGCTGGGAG -3'
(R):5'- TGAGCACTCAGAATCTTGGGTAAC -3'
Posted On2013-04-11