Incidental Mutation 'R1751:Tsc1'
ID193483
Institutional Source Beutler Lab
Gene Symbol Tsc1
Ensembl Gene ENSMUSG00000026812
Gene Nametuberous sclerosis 1
Synonymshamartin
MMRRC Submission 039783-MU
Accession Numbers

Ncbi RefSeq: NM_022887.3; MGI: 1929183

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1751 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28641228-28691167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28676026 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 485 (I485V)
Ref Sequence ENSEMBL: ENSMUSP00000109501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028155] [ENSMUST00000113867] [ENSMUST00000113869] [ENSMUST00000113870] [ENSMUST00000133565] [ENSMUST00000156857]
Predicted Effect probably damaging
Transcript: ENSMUST00000028155
AA Change: I485V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028155
Gene: ENSMUSG00000026812
AA Change: I485V

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113867
AA Change: I485V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109498
Gene: ENSMUSG00000026812
AA Change: I485V

DomainStartEndE-ValueType
Pfam:Hamartin 2 710 7.3e-279 PFAM
SCOP:d1eq1a_ 718 881 6e-11 SMART
low complexity region 969 985 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1094 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113869
AA Change: I486V

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109500
Gene: ENSMUSG00000026812
AA Change: I486V

DomainStartEndE-ValueType
Pfam:Hamartin 7 716 6e-279 PFAM
SCOP:d1eq1a_ 724 887 4e-11 SMART
low complexity region 975 991 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113870
AA Change: I485V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109501
Gene: ENSMUSG00000026812
AA Change: I485V

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125715
Predicted Effect probably benign
Transcript: ENSMUST00000133565
SMART Domains Protein: ENSMUSP00000120888
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 455 1.3e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153625
Predicted Effect probably benign
Transcript: ENSMUST00000156857
SMART Domains Protein: ENSMUSP00000115380
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 348 2.3e-170 PFAM
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 99% (85/86)
MGI Phenotype Strain: 2183900
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants show liver hypoplasia, open neural tube and die by embryonic day 10.5-11.5. Heterozygotes develop kidney cystadenomas and liver hemangiomas. Conditional astrocyte-specific nulls show increased astrocyte numbers and seizures. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(7) Gene trapped(31)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bank1 G T 3: 136,234,614 R203S probably benign Het
Bank1 A G 3: 136,254,937 V53A probably benign Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cdc5l A T 17: 45,407,805 D628E probably benign Het
Chd3 G A 11: 69,353,901 probably benign Het
Clstn3 A T 6: 124,431,999 W860R probably damaging Het
Cntn4 G A 6: 106,618,410 probably null Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Cyp2b9 T C 7: 26,186,675 V89A probably benign Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gart A C 16: 91,642,949 probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gnas T A 2: 174,297,894 probably benign Het
Greb1 A G 12: 16,723,438 probably benign Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gucy2c A T 6: 136,748,775 probably benign Het
Igf2r A C 17: 12,697,441 S1677A possibly damaging Het
Jmjd1c T C 10: 67,225,690 L1274P probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrp6 A G 6: 134,464,568 L1145S probably damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Nol8 A T 13: 49,667,408 T914S probably benign Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr109 A T 17: 37,466,901 M232L probably benign Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pcp4 A C 16: 96,525,489 Q290P probably damaging Het
Pdlim1 C T 19: 40,251,904 probably benign Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Pik3c2a A C 7: 116,346,236 V1445G probably damaging Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Plxnc1 A G 10: 94,849,815 probably benign Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rfx2 A G 17: 56,784,754 V313A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Sbpl A G 17: 23,954,803 probably null Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Setbp1 T C 18: 78,857,398 D1018G probably damaging Het
Slc38a11 T A 2: 65,350,108 I182F probably benign Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Smarca2 T C 19: 26,640,380 probably benign Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Stox1 T C 10: 62,659,666 T943A probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Trpc7 T A 13: 56,776,143 D743V probably damaging Het
Trrap T C 5: 144,814,575 probably null Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Tsr3 T C 17: 25,242,639 I317T possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r108 A T 17: 20,462,524 V806E probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zfp108 C A 7: 24,261,896 H637Q probably damaging Het
Other mutations in Tsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tsc1 APN 2 28661611 missense probably damaging 0.98
IGL00770:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00774:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00835:Tsc1 APN 2 28672466 missense possibly damaging 0.93
IGL00971:Tsc1 APN 2 28670940 nonsense probably null
IGL01808:Tsc1 APN 2 28662507 missense probably damaging 1.00
IGL02281:Tsc1 APN 2 28663595 missense probably damaging 1.00
IGL03068:Tsc1 APN 2 28681258 missense probably damaging 1.00
Cassava UTSW 2 28671886 splice site probably null
R0077:Tsc1 UTSW 2 28678943 splice site probably benign
R0149:Tsc1 UTSW 2 28670901 missense probably damaging 0.99
R0605:Tsc1 UTSW 2 28671778 missense probably damaging 1.00
R0737:Tsc1 UTSW 2 28670930 missense possibly damaging 0.94
R1199:Tsc1 UTSW 2 28665626 missense probably damaging 1.00
R1757:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R1807:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R2014:Tsc1 UTSW 2 28665637 splice site probably benign
R2284:Tsc1 UTSW 2 28665097 missense possibly damaging 0.85
R3786:Tsc1 UTSW 2 28687142 missense probably damaging 1.00
R4490:Tsc1 UTSW 2 28670925 missense probably damaging 0.97
R4707:Tsc1 UTSW 2 28672407 missense probably damaging 1.00
R4751:Tsc1 UTSW 2 28679081 missense probably damaging 0.96
R4794:Tsc1 UTSW 2 28661690 splice site probably null
R4906:Tsc1 UTSW 2 28675189 missense possibly damaging 0.81
R5020:Tsc1 UTSW 2 28676519 missense probably damaging 1.00
R5401:Tsc1 UTSW 2 28686908 nonsense probably null
R5708:Tsc1 UTSW 2 28665185 intron probably benign
R6435:Tsc1 UTSW 2 28676452 missense probably benign 0.08
R6469:Tsc1 UTSW 2 28671886 splice site probably null
R6502:Tsc1 UTSW 2 28665601 missense probably damaging 1.00
R6617:Tsc1 UTSW 2 28686989 missense possibly damaging 0.82
R7098:Tsc1 UTSW 2 28675732 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAAGAGTGTCCTGTCTCAGACC -3'
(R):5'- TGTGTCAGGCCCATGTTTGTCC -3'

Sequencing Primer
(F):5'- TCTCAGACCTGAGCTTGAGAG -3'
(R):5'- CCCATGTTTGTCCAGGGAG -3'
Posted On2014-05-23