Incidental Mutation 'R1751:Arhgef2'
ID193491
Institutional Source Beutler Lab
Gene Symbol Arhgef2
Ensembl Gene ENSMUSG00000028059
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 2
SynonymsP40, Lfc, Lbcl1, GEFH1, LFP40, GEF-H1
MMRRC Submission 039783-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R1751 (G1)
Quality Score197
Status Validated
Chromosome3
Chromosomal Location88605966-88648052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88643953 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 778 (Q778R)
Ref Sequence ENSEMBL: ENSMUSP00000135131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029694] [ENSMUST00000107510] [ENSMUST00000170653] [ENSMUST00000175779] [ENSMUST00000175903] [ENSMUST00000175911] [ENSMUST00000176500] [ENSMUST00000176804] [ENSMUST00000177303] [ENSMUST00000177498]
Predicted Effect probably damaging
Transcript: ENSMUST00000029694
AA Change: Q807R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029694
Gene: ENSMUSG00000028059
AA Change: Q807R

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 240 432 1.86e-58 SMART
PH 474 574 9.56e-11 SMART
coiled coil region 588 619 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
coiled coil region 829 866 N/A INTRINSIC
low complexity region 872 888 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107510
AA Change: Q780R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103134
Gene: ENSMUSG00000028059
AA Change: Q780R

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 213 405 1.86e-58 SMART
PH 447 547 9.56e-11 SMART
coiled coil region 561 592 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
coiled coil region 802 839 N/A INTRINSIC
low complexity region 845 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170653
AA Change: Q778R

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127843
Gene: ENSMUSG00000028059
AA Change: Q778R

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175779
AA Change: Q792R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135177
Gene: ENSMUSG00000028059
AA Change: Q792R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175903
AA Change: Q790R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135168
Gene: ENSMUSG00000028059
AA Change: Q790R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175911
SMART Domains Protein: ENSMUSP00000135428
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
RhoGEF 232 424 1.86e-58 SMART
PH 466 566 9.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176272
Predicted Effect probably damaging
Transcript: ENSMUST00000176500
AA Change: Q792R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134834
Gene: ENSMUSG00000028059
AA Change: Q792R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176804
AA Change: Q805R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135397
Gene: ENSMUSG00000028059
AA Change: Q805R

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 238 430 1.86e-58 SMART
PH 472 572 9.56e-11 SMART
coiled coil region 586 617 N/A INTRINSIC
low complexity region 810 825 N/A INTRINSIC
coiled coil region 827 864 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177099
Predicted Effect probably damaging
Transcript: ENSMUST00000177303
AA Change: Q778R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135131
Gene: ENSMUSG00000028059
AA Change: Q778R

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177418
Predicted Effect probably damaging
Transcript: ENSMUST00000177498
AA Change: Q790R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134840
Gene: ENSMUSG00000028059
AA Change: Q790R

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bank1 G T 3: 136,234,614 R203S probably benign Het
Bank1 A G 3: 136,254,937 V53A probably benign Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cdc5l A T 17: 45,407,805 D628E probably benign Het
Chd3 G A 11: 69,353,901 probably benign Het
Clstn3 A T 6: 124,431,999 W860R probably damaging Het
Cntn4 G A 6: 106,618,410 probably null Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Cyp2b9 T C 7: 26,186,675 V89A probably benign Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gart A C 16: 91,642,949 probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gnas T A 2: 174,297,894 probably benign Het
Greb1 A G 12: 16,723,438 probably benign Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gucy2c A T 6: 136,748,775 probably benign Het
Igf2r A C 17: 12,697,441 S1677A possibly damaging Het
Jmjd1c T C 10: 67,225,690 L1274P probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrp6 A G 6: 134,464,568 L1145S probably damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Nol8 A T 13: 49,667,408 T914S probably benign Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr109 A T 17: 37,466,901 M232L probably benign Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pcp4 A C 16: 96,525,489 Q290P probably damaging Het
Pdlim1 C T 19: 40,251,904 probably benign Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Pik3c2a A C 7: 116,346,236 V1445G probably damaging Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Plxnc1 A G 10: 94,849,815 probably benign Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rfx2 A G 17: 56,784,754 V313A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Sbpl A G 17: 23,954,803 probably null Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Setbp1 T C 18: 78,857,398 D1018G probably damaging Het
Slc38a11 T A 2: 65,350,108 I182F probably benign Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Smarca2 T C 19: 26,640,380 probably benign Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Stox1 T C 10: 62,659,666 T943A probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Trpc7 T A 13: 56,776,143 D743V probably damaging Het
Trrap T C 5: 144,814,575 probably null Het
Tsc1 A G 2: 28,676,026 I485V probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Tsr3 T C 17: 25,242,639 I317T possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r108 A T 17: 20,462,524 V806E probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zfp108 C A 7: 24,261,896 H637Q probably damaging Het
Other mutations in Arhgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Arhgef2 APN 3 88631919 missense probably damaging 1.00
IGL02165:Arhgef2 APN 3 88646220 missense probably damaging 1.00
R0090:Arhgef2 UTSW 3 88639348 missense probably damaging 1.00
R0330:Arhgef2 UTSW 3 88642501 missense probably damaging 1.00
R0414:Arhgef2 UTSW 3 88632268 splice site probably benign
R0631:Arhgef2 UTSW 3 88634436 missense probably damaging 0.99
R1635:Arhgef2 UTSW 3 88639321 critical splice acceptor site probably null
R1688:Arhgef2 UTSW 3 88640300 missense probably benign 0.32
R1767:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1836:Arhgef2 UTSW 3 88639459 missense probably damaging 1.00
R1853:Arhgef2 UTSW 3 88632915 missense possibly damaging 0.48
R1934:Arhgef2 UTSW 3 88629791 missense probably damaging 0.96
R2155:Arhgef2 UTSW 3 88636044 missense probably damaging 1.00
R2206:Arhgef2 UTSW 3 88629914 missense probably damaging 1.00
R2360:Arhgef2 UTSW 3 88634416 missense probably damaging 1.00
R3916:Arhgef2 UTSW 3 88633033 missense probably damaging 1.00
R4090:Arhgef2 UTSW 3 88643878 missense probably benign 0.01
R4732:Arhgef2 UTSW 3 88631940 nonsense probably null
R4733:Arhgef2 UTSW 3 88631940 nonsense probably null
R4837:Arhgef2 UTSW 3 88632943 missense probably damaging 1.00
R4952:Arhgef2 UTSW 3 88642462 missense probably damaging 1.00
R5152:Arhgef2 UTSW 3 88629568 splice site probably null
R5194:Arhgef2 UTSW 3 88635649 missense probably damaging 1.00
R5250:Arhgef2 UTSW 3 88633648 critical splice donor site probably null
R5334:Arhgef2 UTSW 3 88646329 missense probably damaging 0.96
R5514:Arhgef2 UTSW 3 88642997 missense probably benign 0.01
R5560:Arhgef2 UTSW 3 88634437 missense probably damaging 0.97
R5595:Arhgef2 UTSW 3 88642976 missense probably benign 0.00
R5879:Arhgef2 UTSW 3 88643617 splice site probably null
R5910:Arhgef2 UTSW 3 88635020 missense probably damaging 1.00
R5914:Arhgef2 UTSW 3 88635869 missense probably benign
R5918:Arhgef2 UTSW 3 88636080 missense probably damaging 1.00
R6181:Arhgef2 UTSW 3 88635620 missense probably damaging 1.00
R6489:Arhgef2 UTSW 3 88643014 missense probably damaging 1.00
V1662:Arhgef2 UTSW 3 88633329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGACTGATGGAAGCCCTGTTC -3'
(R):5'- AGCTCAAGTATAAAGCGTCGCCC -3'

Sequencing Primer
(F):5'- GAAGCCCTGTTCCCTGAG -3'
(R):5'- AGTGGCTCGTTTTGGCCC -3'
Posted On2014-05-23