Incidental Mutation 'R1751:Greb1'
ID193536
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission 039783-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R1751 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 16723438 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably benign
Transcript: ENSMUST00000048064
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159120
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect probably benign
Transcript: ENSMUST00000162112
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bank1 G T 3: 136,234,614 R203S probably benign Het
Bank1 A G 3: 136,254,937 V53A probably benign Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cdc5l A T 17: 45,407,805 D628E probably benign Het
Chd3 G A 11: 69,353,901 probably benign Het
Clstn3 A T 6: 124,431,999 W860R probably damaging Het
Cntn4 G A 6: 106,618,410 probably null Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Cyp2b9 T C 7: 26,186,675 V89A probably benign Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gart A C 16: 91,642,949 probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gnas T A 2: 174,297,894 probably benign Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gucy2c A T 6: 136,748,775 probably benign Het
Igf2r A C 17: 12,697,441 S1677A possibly damaging Het
Jmjd1c T C 10: 67,225,690 L1274P probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrp6 A G 6: 134,464,568 L1145S probably damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Nol8 A T 13: 49,667,408 T914S probably benign Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr109 A T 17: 37,466,901 M232L probably benign Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pcp4 A C 16: 96,525,489 Q290P probably damaging Het
Pdlim1 C T 19: 40,251,904 probably benign Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Pik3c2a A C 7: 116,346,236 V1445G probably damaging Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Plxnc1 A G 10: 94,849,815 probably benign Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rfx2 A G 17: 56,784,754 V313A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Sbpl A G 17: 23,954,803 probably null Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Setbp1 T C 18: 78,857,398 D1018G probably damaging Het
Slc38a11 T A 2: 65,350,108 I182F probably benign Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Smarca2 T C 19: 26,640,380 probably benign Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Stox1 T C 10: 62,659,666 T943A probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Trpc7 T A 13: 56,776,143 D743V probably damaging Het
Trrap T C 5: 144,814,575 probably null Het
Tsc1 A G 2: 28,676,026 I485V probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Tsr3 T C 17: 25,242,639 I317T possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r108 A T 17: 20,462,524 V806E probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zfp108 C A 7: 24,261,896 H637Q probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCAAGCCTTCCCAATGAAAGC -3'
(R):5'- AACAGGTTATGGAACATGGCACCTC -3'

Sequencing Primer
(F):5'- TTTTGAAGAATGCCGACGCC -3'
(R):5'- ATGGCACCTCTGCCCTG -3'
Posted On2014-05-23