Incidental Mutation 'R1751:Trpc7'
ID193541
Institutional Source Beutler Lab
Gene Symbol Trpc7
Ensembl Gene ENSMUSG00000021541
Gene Nametransient receptor potential cation channel, subfamily C, member 7
SynonymsTrrp8, TRP7
MMRRC Submission 039783-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R1751 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56773113-56895993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56776143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 743 (D743V)
Ref Sequence ENSEMBL: ENSMUSP00000133305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022023] [ENSMUST00000109871] [ENSMUST00000151918] [ENSMUST00000173817] [ENSMUST00000174457]
Predicted Effect probably benign
Transcript: ENSMUST00000022023
AA Change: D798V

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022023
Gene: ENSMUSG00000021541
AA Change: D798V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 6e-28 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Pfam:Ion_trans 387 684 2.4e-34 PFAM
Pfam:PKD_channel 427 679 5.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109871
AA Change: D797V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105497
Gene: ENSMUSG00000021541
AA Change: D797V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 1.1e-31 PFAM
transmembrane domain 352 374 N/A INTRINSIC
transmembrane domain 389 406 N/A INTRINSIC
Pfam:PKD_channel 427 679 1.6e-13 PFAM
Pfam:Ion_trans 441 672 7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151918
SMART Domains Protein: ENSMUSP00000119809
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 4.6e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173067
SMART Domains Protein: ENSMUSP00000134481
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 5.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173466
SMART Domains Protein: ENSMUSP00000134285
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 9.5e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173513
AA Change: D681V

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134662
Gene: ENSMUSG00000021541
AA Change: D681V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.5e-31 PFAM
Pfam:PKD_channel 311 563 2.6e-13 PFAM
Pfam:Ion_trans 325 556 1.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173817
AA Change: D737V

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133411
Gene: ENSMUSG00000021541
AA Change: D737V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 345 N/A INTRINSIC
Pfam:PKD_channel 366 618 3.7e-13 PFAM
Pfam:Ion_trans 380 611 1.2e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174457
AA Change: D743V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133305
Gene: ENSMUSG00000021541
AA Change: D743V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
Pfam:PKD_channel 372 624 3.8e-13 PFAM
Pfam:Ion_trans 386 617 1.3e-35 PFAM
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the transient receptor potential channel family of proteins, which form six-transmembrane cation-permeable channels that are calcium permeant. Knock out mice are viable but display a reduction in the gamma wave activity that precedes seizure induction in response to a muscrarinic agonist, suggesting a functional role for this protein in initiation of seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bank1 G T 3: 136,234,614 R203S probably benign Het
Bank1 A G 3: 136,254,937 V53A probably benign Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cdc5l A T 17: 45,407,805 D628E probably benign Het
Chd3 G A 11: 69,353,901 probably benign Het
Clstn3 A T 6: 124,431,999 W860R probably damaging Het
Cntn4 G A 6: 106,618,410 probably null Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Cyp2b9 T C 7: 26,186,675 V89A probably benign Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Fzd8 C T 18: 9,213,643 R242C probably damaging Het
Gart A C 16: 91,642,949 probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gnas T A 2: 174,297,894 probably benign Het
Greb1 A G 12: 16,723,438 probably benign Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gucy2c A T 6: 136,748,775 probably benign Het
Igf2r A C 17: 12,697,441 S1677A possibly damaging Het
Jmjd1c T C 10: 67,225,690 L1274P probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrp6 A G 6: 134,464,568 L1145S probably damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Nol8 A T 13: 49,667,408 T914S probably benign Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr109 A T 17: 37,466,901 M232L probably benign Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pcp4 A C 16: 96,525,489 Q290P probably damaging Het
Pdlim1 C T 19: 40,251,904 probably benign Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Pik3c2a A C 7: 116,346,236 V1445G probably damaging Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Plxnc1 A G 10: 94,849,815 probably benign Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rfx2 A G 17: 56,784,754 V313A probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Sbpl A G 17: 23,954,803 probably null Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Setbp1 T C 18: 78,857,398 D1018G probably damaging Het
Slc38a11 T A 2: 65,350,108 I182F probably benign Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Smarca2 T C 19: 26,640,380 probably benign Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Stox1 T C 10: 62,659,666 T943A probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Trrap T C 5: 144,814,575 probably null Het
Tsc1 A G 2: 28,676,026 I485V probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Tsr3 T C 17: 25,242,639 I317T possibly damaging Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r108 A T 17: 20,462,524 V806E probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zfp108 C A 7: 24,261,896 H637Q probably damaging Het
Other mutations in Trpc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Trpc7 APN 13 56773809 missense possibly damaging 0.64
IGL00809:Trpc7 APN 13 56822488 missense probably benign 0.00
IGL01011:Trpc7 APN 13 56804540 missense probably damaging 1.00
IGL01517:Trpc7 APN 13 56861065 missense probably damaging 1.00
IGL01824:Trpc7 APN 13 56789722 nonsense probably null
IGL02055:Trpc7 APN 13 56887544 missense probably benign 0.13
IGL02267:Trpc7 APN 13 56860930 missense probably damaging 1.00
IGL02323:Trpc7 APN 13 56783751 missense possibly damaging 0.91
IGL02451:Trpc7 APN 13 56822461 missense probably damaging 0.98
IGL02635:Trpc7 APN 13 56776168 missense probably damaging 1.00
IGL03335:Trpc7 APN 13 56887691 missense probably damaging 1.00
R0217:Trpc7 UTSW 13 56789768 nonsense probably null
R0611:Trpc7 UTSW 13 56887823 missense probably damaging 1.00
R0919:Trpc7 UTSW 13 56822649 splice site probably benign
R1235:Trpc7 UTSW 13 56887539 missense probably damaging 1.00
R4324:Trpc7 UTSW 13 56887356 missense probably damaging 0.99
R4649:Trpc7 UTSW 13 56887554 missense probably damaging 1.00
R4731:Trpc7 UTSW 13 56804553 missense probably damaging 1.00
R5379:Trpc7 UTSW 13 56804550 missense probably damaging 1.00
R5834:Trpc7 UTSW 13 56776158 missense probably damaging 1.00
R5985:Trpc7 UTSW 13 56810545 missense probably damaging 0.96
R6244:Trpc7 UTSW 13 56773892 missense probably damaging 1.00
R6599:Trpc7 UTSW 13 56810380 splice site probably null
R6778:Trpc7 UTSW 13 56804687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGGAATGCATCTGCTTGCAC -3'
(R):5'- ATTTGCCTGGCTGACCTGATAAGAC -3'

Sequencing Primer
(F):5'- GCATCTGCTTGCACTAAAGAG -3'
(R):5'- gggaggtggggaggtgg -3'
Posted On2014-05-23