Incidental Mutation 'R0017:Rpa1'
ID19362
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Namereplication protein A1
SynonymsRpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission 038312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0017 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location75298166-75348324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 75314861 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 223 (N223K)
Ref Sequence ENSEMBL: ENSMUSP00000090585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
Predicted Effect probably null
Transcript: ENSMUST00000000767
AA Change: N244K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: N244K

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092907
AA Change: N223K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: N223K

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198372
Meta Mutation Damage Score 0.6376 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,008,106 probably benign Het
Abca13 T A 11: 9,292,775 I1546N probably damaging Het
Actrt3 A T 3: 30,598,273 M224K probably benign Het
Adgrv1 T C 13: 81,578,946 N429S probably benign Het
Appbp2 A C 11: 85,214,303 C146G possibly damaging Het
Cabp2 A C 19: 4,086,242 D83A possibly damaging Het
Ccl1 A G 11: 82,178,017 probably null Het
Cdca8 T C 4: 124,920,375 T208A probably benign Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dcdc5 G A 2: 106,357,196 noncoding transcript Het
Efr3b C A 12: 3,993,003 C89F probably damaging Het
Enpp3 C T 10: 24,799,153 probably null Het
Ep400 A T 5: 110,673,529 V2467E probably damaging Het
Ermap T C 4: 119,179,948 probably benign Het
Fig4 A G 10: 41,273,007 Y150H possibly damaging Het
Fsip2 G A 2: 82,992,072 V6050M probably damaging Het
Gm11397 A C 13: 33,404,511 I360L probably damaging Het
Gnb1l T C 16: 18,541,060 W72R probably damaging Het
Gpld1 A G 13: 24,990,118 D842G probably damaging Het
Hmgcr A G 13: 96,652,089 probably benign Het
Hrc A G 7: 45,336,370 H315R possibly damaging Het
Ifit2 A T 19: 34,573,573 N171I probably damaging Het
Ipo11 T A 13: 106,886,730 I416L probably benign Het
Kcnab1 G A 3: 65,357,106 V259M probably damaging Het
Kcng4 T C 8: 119,633,520 Y39C probably damaging Het
Kif5c A G 2: 49,732,713 T526A probably benign Het
Kntc1 A G 5: 123,780,981 Y805C probably damaging Het
Mal A G 2: 127,640,307 S59P probably damaging Het
Myh15 A G 16: 49,163,060 N1513D probably damaging Het
Ncoa2 A G 1: 13,174,752 L574P probably damaging Het
Nmd3 A G 3: 69,736,092 probably null Het
Nucb2 A G 7: 116,533,151 D331G probably benign Het
Nwd1 T C 8: 72,709,425 probably benign Het
Nynrin T C 14: 55,872,395 F1653S probably damaging Het
Olfr1253 A C 2: 89,752,021 I269S possibly damaging Het
Olfr371 T A 8: 85,231,077 I194N probably benign Het
Olfr875 T G 9: 37,772,978 F106L probably benign Het
Pfdn6 T C 17: 33,939,564 R79G probably damaging Het
Pkd1 G T 17: 24,578,539 probably null Het
Pramel4 T G 4: 144,068,344 C434G probably benign Het
Ptpn13 T C 5: 103,486,772 probably null Het
Ptpro T C 6: 137,416,827 V831A probably benign Het
Rabl6 A T 2: 25,602,567 probably benign Het
Reg3b T A 6: 78,372,861 M128K possibly damaging Het
Rif1 A G 2: 52,116,674 T2207A probably benign Het
Rras2 T C 7: 114,048,255 probably benign Het
Ryr1 T A 7: 29,047,542 E3760V probably damaging Het
Scyl3 T A 1: 163,939,969 I204N possibly damaging Het
Slc16a12 A G 19: 34,672,698 probably benign Het
Slc22a1 A G 17: 12,659,759 F356L probably damaging Het
Slc22a29 A G 19: 8,218,266 probably benign Het
Slc45a1 C A 4: 150,629,566 D741Y possibly damaging Het
Slco1a5 A T 6: 142,236,335 probably benign Het
Smg5 G T 3: 88,351,105 R461L probably damaging Het
Snrk T C 9: 122,166,240 S362P probably damaging Het
Spata31d1b A G 13: 59,716,069 S344G probably benign Het
Sync G A 4: 129,293,744 V190M probably damaging Het
Taf5l T C 8: 124,003,644 Y67C probably damaging Het
Tbkbp1 A G 11: 97,146,289 probably benign Het
Tshr A T 12: 91,537,886 I533F possibly damaging Het
Tsn T C 1: 118,300,859 D211G probably damaging Het
Ttn G A 2: 76,791,644 T15518I probably benign Het
Unc13c T C 9: 73,693,301 D1387G probably benign Het
Vapb A G 2: 173,771,604 T99A probably benign Het
Vmn2r-ps119 A G 17: 19,153,617 noncoding transcript Het
Zfp280d A T 9: 72,339,010 probably null Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCACAATGACCGCCATGTTC -3'
(R):5'- CCTTTTATGGTAGGCGCTCTCTCAG -3'

Sequencing Primer
(F):5'- CCATGTTCCTCGGAGCTG -3'
(R):5'- CGGCTCCTGTAATTGAAAATAGTGG -3'
Posted On2013-04-11