Incidental Mutation 'R1752:Fam208a'
ID193654
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 039784-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1752 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 27471928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1028 (Y1028*)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably null
Transcript: ENSMUST00000022450
AA Change: Y1028*
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: Y1028*

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,006,634 V1134A probably benign Het
Accsl C T 2: 93,858,030 G420S probably damaging Het
Adam29 A G 8: 55,872,274 S382P probably damaging Het
Apob T C 12: 7,988,766 L393P probably benign Het
Arhgef19 T G 4: 141,251,043 S616A probably benign Het
Atp11a C T 8: 12,813,094 T91I probably damaging Het
Ccdc88b C T 19: 6,853,322 V751I probably benign Het
Ccni T C 5: 93,202,456 probably benign Het
Cd2 G A 3: 101,276,195 A266V probably benign Het
Cd33 T C 7: 43,532,298 D146G probably benign Het
Cdh16 A G 8: 104,619,873 probably null Het
Chd1 T C 17: 15,743,232 probably null Het
Chd5 A T 4: 152,375,133 I1109F probably damaging Het
Cir1 T C 2: 73,310,538 E29G probably damaging Het
Clec5a T C 6: 40,582,253 T66A probably damaging Het
Cpa2 A G 6: 30,552,024 D250G probably damaging Het
Crybg2 T A 4: 134,073,650 L707H probably damaging Het
Csmd3 T C 15: 47,660,273 T2646A probably benign Het
Cul7 G A 17: 46,653,167 R390Q probably benign Het
Cyp2c69 T A 19: 39,881,153 I141F probably damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Dclk2 C T 3: 86,806,127 V470I possibly damaging Het
Dixdc1 A G 9: 50,682,550 V530A probably benign Het
Dock7 A G 4: 98,966,444 F1528L probably damaging Het
Edn1 T A 13: 42,303,599 V36E possibly damaging Het
Eng T C 2: 32,673,392 V319A probably benign Het
Epb41l2 A G 10: 25,460,792 K229E probably damaging Het
Fam184a T C 10: 53,674,570 N698S probably benign Het
Fndc7 T C 3: 108,869,330 N465S probably benign Het
Fstl4 T C 11: 53,186,795 V793A probably benign Het
Gm884 T C 11: 103,614,555 T2196A possibly damaging Het
Gm9797 A T 10: 11,609,543 noncoding transcript Het
Hsd17b4 T C 18: 50,170,767 S436P probably benign Het
Itsn2 T G 12: 4,711,950 probably null Het
Kank3 T C 17: 33,819,817 V570A probably damaging Het
Kif13a A T 13: 46,798,409 F733Y probably damaging Het
Kif16b G T 2: 142,690,666 D1184E probably benign Het
Kif20a A G 18: 34,631,581 D727G possibly damaging Het
Kif20b T A 19: 34,938,336 S504R probably benign Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Luzp2 T C 7: 55,264,340 S306P possibly damaging Het
Macf1 T C 4: 123,483,672 I1490V possibly damaging Het
Manba T A 3: 135,506,945 W72R probably damaging Het
Mast1 A G 8: 84,925,336 V339A probably benign Het
Mnx1 A G 5: 29,477,729 S183P unknown Het
Muc5b T G 7: 141,867,751 L4326R possibly damaging Het
Myb T C 10: 21,156,437 D15G possibly damaging Het
Ncapg2 A T 12: 116,426,718 D429V probably damaging Het
Neurod6 A G 6: 55,679,526 V42A probably benign Het
Nfxl1 A T 5: 72,540,875 C276S probably damaging Het
Nptx2 C A 5: 144,555,361 T316N probably damaging Het
Nrp2 T A 1: 62,738,441 F135Y probably damaging Het
Nxpe3 A T 16: 55,866,474 F57Y probably benign Het
Olfr1214 C A 2: 88,987,315 A296S possibly damaging Het
Olfr610 T A 7: 103,506,558 R129S probably benign Het
Osbpl11 T C 16: 33,204,835 Y144H probably damaging Het
Pax5 T C 4: 44,609,729 Y233C probably damaging Het
Pck1 A G 2: 173,157,113 N388S probably benign Het
Plcd3 T A 11: 103,080,259 Q157L probably benign Het
Pnma2 A C 14: 66,916,336 M70L probably benign Het
Pogk T C 1: 166,408,428 K35E probably damaging Het
Ptprb T A 10: 116,340,990 V1227E probably benign Het
Pygm T A 19: 6,391,034 V450E probably damaging Het
Rb1 T A 14: 73,287,624 I190F probably damaging Het
Setd2 T A 9: 110,594,605 Y2243N probably damaging Het
Slc11a2 A T 15: 100,405,806 L182Q probably damaging Het
Slc45a3 T C 1: 131,977,521 L94P probably damaging Het
Slc9a4 T C 1: 40,629,261 F688S probably benign Het
Slit3 A T 11: 35,564,653 I196F probably damaging Het
Sprn G A 7: 140,153,495 probably benign Het
Spsb2 A G 6: 124,810,329 D242G probably benign Het
Srpk2 A G 5: 23,528,019 I111T probably damaging Het
St8sia4 T A 1: 95,591,812 Y317F probably benign Het
Stat5a T A 11: 100,884,058 *798K probably null Het
Sult1c1 C T 17: 53,964,749 V137M possibly damaging Het
Synj1 T C 16: 90,938,473 T1531A probably benign Het
Tax1bp1 A G 6: 52,721,413 T37A probably damaging Het
Tet1 T A 10: 62,812,989 D1888V probably damaging Het
Tln1 T C 4: 43,536,311 T1994A probably damaging Het
Tmco3 A C 8: 13,291,741 D5A probably benign Het
Tnk1 T A 11: 69,856,706 N74I possibly damaging Het
Ttc16 A T 2: 32,772,150 S120T probably damaging Het
Ttn A G 2: 76,764,262 V20480A probably damaging Het
Ttn T A 2: 76,944,104 T2153S probably damaging Het
Usp4 T C 9: 108,374,242 Y539H probably damaging Het
Zar1 A C 5: 72,577,372 V168G probably damaging Het
Zcchc9 T C 13: 91,805,780 K119E possibly damaging Het
Zfp251 T C 15: 76,853,663 N410S possibly damaging Het
Zfp605 A T 5: 110,123,773 D10V probably damaging Het
Zyg11a A T 4: 108,205,282 N107K possibly damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTAAAAGGCACTACCGAGGAGGAC -3'
(R):5'- TTCCCAGAGAAGCCAATGCTGCTG -3'

Sequencing Primer
(F):5'- CTACCGAGGAGGACACTGTAAC -3'
(R):5'- TGCAGCATGGGAATGATTAGC -3'
Posted On2014-05-23