Incidental Mutation 'R0017:Gnb1l'
ID19373
Institutional Source Beutler Lab
Gene Symbol Gnb1l
Ensembl Gene ENSMUSG00000000884
Gene Nameguanine nucleotide binding protein (G protein), beta polypeptide 1-like
SynonymsESTM55, Wdvcf, Wdr14, Me49f07
MMRRC Submission 038312-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R0017 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location18498713-18566679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18541060 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 72 (W72R)
Ref Sequence ENSEMBL: ENSMUSP00000000904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000904] [ENSMUST00000090086] [ENSMUST00000115600] [ENSMUST00000115601] [ENSMUST00000139625] [ENSMUST00000147739] [ENSMUST00000149035] [ENSMUST00000167778] [ENSMUST00000231621]
Predicted Effect probably damaging
Transcript: ENSMUST00000000904
AA Change: W72R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000904
Gene: ENSMUSG00000000884
AA Change: W72R

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 112 143 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000090086
AA Change: W72R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087544
Gene: ENSMUSG00000000884
AA Change: W72R

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115600
AA Change: W72R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111263
Gene: ENSMUSG00000000884
AA Change: W72R

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 136 188 3e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000115601
AA Change: W72R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111264
Gene: ENSMUSG00000000884
AA Change: W72R

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 138 179 1e-16 BLAST
WD40 182 221 4.79e-1 SMART
WD40 224 266 4.79e-1 SMART
WD40 269 307 6.04e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129952
Predicted Effect probably benign
Transcript: ENSMUST00000139625
SMART Domains Protein: ENSMUSP00000120897
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
Blast:WD40 35 75 2e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000147739
AA Change: W72R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123200
Gene: ENSMUSG00000000884
AA Change: W72R

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149035
SMART Domains Protein: ENSMUSP00000114875
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
Blast:WD40 35 76 8e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000167778
AA Change: W72R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130371
Gene: ENSMUSG00000000884
AA Change: W72R

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231621
AA Change: W72R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232235
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a gene trapped allele exhibit significantly reduced prepulse inhibition. Homozygotes die during early gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,008,106 probably benign Het
Abca13 T A 11: 9,292,775 I1546N probably damaging Het
Actrt3 A T 3: 30,598,273 M224K probably benign Het
Adgrv1 T C 13: 81,578,946 N429S probably benign Het
Appbp2 A C 11: 85,214,303 C146G possibly damaging Het
Cabp2 A C 19: 4,086,242 D83A possibly damaging Het
Ccl1 A G 11: 82,178,017 probably null Het
Cdca8 T C 4: 124,920,375 T208A probably benign Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dcdc5 G A 2: 106,357,196 noncoding transcript Het
Efr3b C A 12: 3,993,003 C89F probably damaging Het
Enpp3 C T 10: 24,799,153 probably null Het
Ep400 A T 5: 110,673,529 V2467E probably damaging Het
Ermap T C 4: 119,179,948 probably benign Het
Fig4 A G 10: 41,273,007 Y150H possibly damaging Het
Fsip2 G A 2: 82,992,072 V6050M probably damaging Het
Gm11397 A C 13: 33,404,511 I360L probably damaging Het
Gpld1 A G 13: 24,990,118 D842G probably damaging Het
Hmgcr A G 13: 96,652,089 probably benign Het
Hrc A G 7: 45,336,370 H315R possibly damaging Het
Ifit2 A T 19: 34,573,573 N171I probably damaging Het
Ipo11 T A 13: 106,886,730 I416L probably benign Het
Kcnab1 G A 3: 65,357,106 V259M probably damaging Het
Kcng4 T C 8: 119,633,520 Y39C probably damaging Het
Kif5c A G 2: 49,732,713 T526A probably benign Het
Kntc1 A G 5: 123,780,981 Y805C probably damaging Het
Mal A G 2: 127,640,307 S59P probably damaging Het
Myh15 A G 16: 49,163,060 N1513D probably damaging Het
Ncoa2 A G 1: 13,174,752 L574P probably damaging Het
Nmd3 A G 3: 69,736,092 probably null Het
Nucb2 A G 7: 116,533,151 D331G probably benign Het
Nwd1 T C 8: 72,709,425 probably benign Het
Nynrin T C 14: 55,872,395 F1653S probably damaging Het
Olfr1253 A C 2: 89,752,021 I269S possibly damaging Het
Olfr371 T A 8: 85,231,077 I194N probably benign Het
Olfr875 T G 9: 37,772,978 F106L probably benign Het
Pfdn6 T C 17: 33,939,564 R79G probably damaging Het
Pkd1 G T 17: 24,578,539 probably null Het
Pramel4 T G 4: 144,068,344 C434G probably benign Het
Ptpn13 T C 5: 103,486,772 probably null Het
Ptpro T C 6: 137,416,827 V831A probably benign Het
Rabl6 A T 2: 25,602,567 probably benign Het
Reg3b T A 6: 78,372,861 M128K possibly damaging Het
Rif1 A G 2: 52,116,674 T2207A probably benign Het
Rpa1 A C 11: 75,314,861 N223K probably null Het
Rras2 T C 7: 114,048,255 probably benign Het
Ryr1 T A 7: 29,047,542 E3760V probably damaging Het
Scyl3 T A 1: 163,939,969 I204N possibly damaging Het
Slc16a12 A G 19: 34,672,698 probably benign Het
Slc22a1 A G 17: 12,659,759 F356L probably damaging Het
Slc22a29 A G 19: 8,218,266 probably benign Het
Slc45a1 C A 4: 150,629,566 D741Y possibly damaging Het
Slco1a5 A T 6: 142,236,335 probably benign Het
Smg5 G T 3: 88,351,105 R461L probably damaging Het
Snrk T C 9: 122,166,240 S362P probably damaging Het
Spata31d1b A G 13: 59,716,069 S344G probably benign Het
Sync G A 4: 129,293,744 V190M probably damaging Het
Taf5l T C 8: 124,003,644 Y67C probably damaging Het
Tbkbp1 A G 11: 97,146,289 probably benign Het
Tshr A T 12: 91,537,886 I533F possibly damaging Het
Tsn T C 1: 118,300,859 D211G probably damaging Het
Ttn G A 2: 76,791,644 T15518I probably benign Het
Unc13c T C 9: 73,693,301 D1387G probably benign Het
Vapb A G 2: 173,771,604 T99A probably benign Het
Vmn2r-ps119 A G 17: 19,153,617 noncoding transcript Het
Zfp280d A T 9: 72,339,010 probably null Het
Other mutations in Gnb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Gnb1l APN 16 18544200 missense probably damaging 1.00
IGL02860:Gnb1l APN 16 18552535 missense probably damaging 0.99
IGL03155:Gnb1l APN 16 18540532 intron probably null
IGL03169:Gnb1l APN 16 18540455 missense probably damaging 1.00
R0267:Gnb1l UTSW 16 18548089 splice site probably benign
R0365:Gnb1l UTSW 16 18552461 missense possibly damaging 0.95
R0845:Gnb1l UTSW 16 18552473 missense probably benign 0.01
R2975:Gnb1l UTSW 16 18564266 missense probably damaging 1.00
R3438:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R3439:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R4650:Gnb1l UTSW 16 18544275 critical splice donor site probably null
R4776:Gnb1l UTSW 16 18548096 nonsense probably null
R7135:Gnb1l UTSW 16 18545168 missense probably benign 0.05
R7290:Gnb1l UTSW 16 18564056 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTCAGCGTCAGCCATCAGTTCC -3'
(R):5'- AGACCTGTCTCAGAGCACCAAAGG -3'

Sequencing Primer
(F):5'- AGCTGAAGTATCTTCATCCACGG -3'
(R):5'- GAGTCATCTACTTCCCAAAGGCTG -3'
Posted On2013-04-11