Incidental Mutation 'R1753:Celsr3'
ID193758
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission 039785-MU
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1753 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108831857 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1301 (V1301F)
Ref Sequence ENSEMBL: ENSMUSP00000024238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]
Predicted Effect probably damaging
Transcript: ENSMUST00000024238
AA Change: V1301F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: V1301F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192235
AA Change: V40F

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473
AA Change: V40F

DomainStartEndE-ValueType
low complexity region 67 74 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
EGF 108 163 4.9e-5 SMART
EGF 168 201 2.6e-6 SMART
EGF_like 208 239 1.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193726
Predicted Effect probably damaging
Transcript: ENSMUST00000213524
AA Change: V1301F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,973,716 F409I probably benign Het
Adamts19 A C 18: 59,007,372 I848L possibly damaging Het
Adamts5 T C 16: 85,899,352 S306G probably damaging Het
Adamts8 T G 9: 30,954,614 I486S probably benign Het
Adgrg5 T C 8: 94,942,052 F499L possibly damaging Het
Akr1c21 T A 13: 4,577,135 C145* probably null Het
Anp32b T G 4: 46,460,241 probably null Het
Arhgap31 A G 16: 38,601,612 V1364A possibly damaging Het
C2cd6 T C 1: 59,094,833 R10G possibly damaging Het
Cacna2d1 A G 5: 16,302,354 E367G possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cd2 A T 3: 101,287,499 M91K possibly damaging Het
Cdc16 C A 8: 13,764,688 Y157* probably null Het
Cep164 C T 9: 45,792,937 G961S probably damaging Het
Cep290 T C 10: 100,513,981 V630A probably benign Het
Chd5 C T 4: 152,378,815 S1451F probably damaging Het
Cldn23 A C 8: 35,825,986 L116R possibly damaging Het
Cngb1 A T 8: 95,297,773 probably benign Het
Cpb1 G T 3: 20,266,241 N151K possibly damaging Het
Cpn2 A G 16: 30,260,100 F261S probably damaging Het
Crlf3 A C 11: 80,057,872 V249G probably damaging Het
Csmd1 A T 8: 16,157,120 Y1298* probably null Het
Cstf2t C A 19: 31,083,685 P207Q possibly damaging Het
Cym A C 3: 107,213,425 L288R possibly damaging Het
Cyp2j12 C T 4: 96,121,432 probably null Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnmt3a A T 12: 3,873,342 M181L possibly damaging Het
Duox1 T A 2: 122,333,429 M859K probably damaging Het
Eif2b4 A T 5: 31,192,940 S13T probably benign Het
Ercc6 T C 14: 32,576,999 V1448A probably benign Het
Esp24 A G 17: 39,040,002 E31G possibly damaging Het
F2rl2 T A 13: 95,701,461 M338K probably benign Het
Fgfbp1 A C 5: 43,979,923 L9R possibly damaging Het
Gal3st2b A T 1: 93,940,616 N188Y probably damaging Het
Gpr179 G C 11: 97,346,578 C372W probably damaging Het
Grn T G 11: 102,433,267 C61G probably damaging Het
Herc1 T G 9: 66,469,010 C3371G probably damaging Het
Herc1 T C 9: 66,502,084 probably null Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ifi35 A T 11: 101,456,635 R31W probably damaging Het
Ifit1bl1 T A 19: 34,593,860 H399L probably benign Het
Irx3 G A 8: 91,800,734 P114L probably damaging Het
Kat6a T A 8: 22,935,797 D1119E probably benign Het
Kmt2d G T 15: 98,843,482 probably benign Het
Kng1 A T 16: 23,079,119 H423L possibly damaging Het
Lrp2 T A 2: 69,496,489 Q1746L possibly damaging Het
Lrrc29 A T 8: 105,313,192 V517E probably damaging Het
Lrrc63 A T 14: 75,086,344 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Map3k19 A G 1: 127,822,680 M978T probably benign Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Mpo A G 11: 87,795,881 N85D probably benign Het
Mpp4 T C 1: 59,144,810 D244G probably null Het
Mstn A G 1: 53,066,558 Y353C probably damaging Het
Mx1 T A 16: 97,454,158 N232Y probably damaging Het
Mycs T C X: 5,468,103 R308G probably benign Het
Myh11 A T 16: 14,277,870 D9E probably benign Het
Nfe2l3 A T 6: 51,433,412 Q169L probably null Het
Nr5a1 G T 2: 38,708,419 T122N possibly damaging Het
Nras A G 3: 103,058,979 T20A probably damaging Het
Obp2b T A 2: 25,738,640 probably null Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr1143 T A 2: 87,802,762 F124L probably benign Het
Olfr1410 G A 1: 92,608,400 V188M probably benign Het
Olfr365 A G 2: 37,201,427 Y62C probably damaging Het
Olfr577 T C 7: 102,973,056 N312S probably benign Het
Pcdh17 A T 14: 84,477,654 T920S probably benign Het
Pcdh9 T C 14: 93,887,225 D503G probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pde6b C A 5: 108,388,691 C84* probably null Het
Pex1 A T 5: 3,630,044 N914I probably damaging Het
Pign A G 1: 105,589,317 V528A possibly damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Ppip5k1 T C 2: 121,342,631 K489E probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Radil T C 5: 142,495,336 Y572C probably damaging Het
Rapgef2 A G 3: 79,088,791 I555T possibly damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
Rnaset2b G A 17: 6,981,107 probably null Het
S1pr1 A G 3: 115,711,938 S336P probably benign Het
Slc24a5 A G 2: 125,083,195 E252G possibly damaging Het
Slc34a2 A T 5: 53,061,391 I184F probably benign Het
Slc35a3 A G 3: 116,677,948 V224A possibly damaging Het
Slc39a9 A G 12: 80,677,202 H211R probably damaging Het
Slu7 A G 11: 43,439,268 N174S probably benign Het
Smarcd3 A T 5: 24,595,822 Y131* probably null Het
Syne1 A G 10: 5,367,621 M491T probably benign Het
Tars G A 15: 11,394,243 Q103* probably null Het
Tmem132d C A 5: 127,789,855 E660D probably benign Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T A 2: 76,752,261 M22763L probably benign Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Ubp1 A T 9: 113,955,969 I117L possibly damaging Het
Usp24 T A 4: 106,377,559 H954Q probably benign Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn2r63 G A 7: 42,928,245 Q290* probably null Het
Vnn3 T C 10: 23,865,820 I341T probably benign Het
Wbp2nl A G 15: 82,305,744 T46A probably damaging Het
Wdr48 G T 9: 119,924,247 E625* probably null Het
Wdr6 C T 9: 108,575,164 V507I probably damaging Het
Zp2 A T 7: 120,138,105 W287R probably benign Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
Diminishment UTSW 9 108842708 intron probably benign
little_d UTSW 9 108827692 missense probably damaging 0.98
nogal UTSW 9 108835838 missense probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
PIT4243001:Celsr3 UTSW 9 108832308 missense probably benign 0.13
PIT4810001:Celsr3 UTSW 9 108845733 missense probably damaging 1.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1657:Celsr3 UTSW 9 108842952 nonsense probably null
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
R7061:Celsr3 UTSW 9 108847594 nonsense probably null
R7122:Celsr3 UTSW 9 108828567 missense possibly damaging 0.90
R7156:Celsr3 UTSW 9 108838004 missense possibly damaging 0.95
R7166:Celsr3 UTSW 9 108842951 missense probably damaging 1.00
R7176:Celsr3 UTSW 9 108845762 missense probably benign
R7213:Celsr3 UTSW 9 108849040 missense probably damaging 0.98
R7314:Celsr3 UTSW 9 108829144 missense probably damaging 1.00
R7478:Celsr3 UTSW 9 108843578 missense probably benign 0.37
R7653:Celsr3 UTSW 9 108835070 nonsense probably null
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACCCGAAACTGATCACTGTCCC -3'
(R):5'- CAGGCACACGTTGTCGTCAAAG -3'

Sequencing Primer
(F):5'- CAGATGGCCTGCATAGTGTTAC -3'
(R):5'- TTGTCGTCAAAGGGCAGC -3'
Posted On2014-05-23