Incidental Mutation 'R1753:Grn'
ID193771
Institutional Source Beutler Lab
Gene Symbol Grn
Ensembl Gene ENSMUSG00000034708
Gene Namegranulin
Synonymsprogranulin, epithelin, acrogranulin, PC cell-derived growth factor, Pgrn
MMRRC Submission 039785-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R1753 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102430315-102437048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102433267 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 61 (C61G)
Ref Sequence ENSEMBL: ENSMUSP00000135739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]
Predicted Effect probably benign
Transcript: ENSMUST00000049057
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049460
AA Change: C74G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708
AA Change: C74G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123500
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127530
Predicted Effect probably damaging
Transcript: ENSMUST00000129997
AA Change: C61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708
AA Change: C61G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GRAN 61 112 1.32e-22 SMART
GRAN 125 177 7.38e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176953
Predicted Effect probably benign
Transcript: ENSMUST00000177428
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some knock-out alleles display enhanced macrophage functions. Mice homozygous for another knock-out allele display reproductive and behavioral abnormalities. Mice homozygous for a third null allele display premature death and increased cellular aging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A T 11: 109,973,716 F409I probably benign Het
Adamts19 A C 18: 59,007,372 I848L possibly damaging Het
Adamts5 T C 16: 85,899,352 S306G probably damaging Het
Adamts8 T G 9: 30,954,614 I486S probably benign Het
Adgrg5 T C 8: 94,942,052 F499L possibly damaging Het
Akr1c21 T A 13: 4,577,135 C145* probably null Het
Anp32b T G 4: 46,460,241 probably null Het
Arhgap31 A G 16: 38,601,612 V1364A possibly damaging Het
C2cd6 T C 1: 59,094,833 R10G possibly damaging Het
Cacna2d1 A G 5: 16,302,354 E367G possibly damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cd2 A T 3: 101,287,499 M91K possibly damaging Het
Cdc16 C A 8: 13,764,688 Y157* probably null Het
Celsr3 G T 9: 108,831,857 V1301F probably damaging Het
Cep164 C T 9: 45,792,937 G961S probably damaging Het
Cep290 T C 10: 100,513,981 V630A probably benign Het
Chd5 C T 4: 152,378,815 S1451F probably damaging Het
Cldn23 A C 8: 35,825,986 L116R possibly damaging Het
Cngb1 A T 8: 95,297,773 probably benign Het
Cpb1 G T 3: 20,266,241 N151K possibly damaging Het
Cpn2 A G 16: 30,260,100 F261S probably damaging Het
Crlf3 A C 11: 80,057,872 V249G probably damaging Het
Csmd1 A T 8: 16,157,120 Y1298* probably null Het
Cstf2t C A 19: 31,083,685 P207Q possibly damaging Het
Cym A C 3: 107,213,425 L288R possibly damaging Het
Cyp2j12 C T 4: 96,121,432 probably null Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnmt3a A T 12: 3,873,342 M181L possibly damaging Het
Duox1 T A 2: 122,333,429 M859K probably damaging Het
Eif2b4 A T 5: 31,192,940 S13T probably benign Het
Ercc6 T C 14: 32,576,999 V1448A probably benign Het
Esp24 A G 17: 39,040,002 E31G possibly damaging Het
F2rl2 T A 13: 95,701,461 M338K probably benign Het
Fgfbp1 A C 5: 43,979,923 L9R possibly damaging Het
Gal3st2b A T 1: 93,940,616 N188Y probably damaging Het
Gpr179 G C 11: 97,346,578 C372W probably damaging Het
Herc1 T G 9: 66,469,010 C3371G probably damaging Het
Herc1 T C 9: 66,502,084 probably null Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ifi35 A T 11: 101,456,635 R31W probably damaging Het
Ifit1bl1 T A 19: 34,593,860 H399L probably benign Het
Irx3 G A 8: 91,800,734 P114L probably damaging Het
Kat6a T A 8: 22,935,797 D1119E probably benign Het
Kmt2d G T 15: 98,843,482 probably benign Het
Kng1 A T 16: 23,079,119 H423L possibly damaging Het
Lrp2 T A 2: 69,496,489 Q1746L possibly damaging Het
Lrrc29 A T 8: 105,313,192 V517E probably damaging Het
Lrrc63 A T 14: 75,086,344 probably null Het
Mad2l1 T A 6: 66,539,813 V163E possibly damaging Het
Map3k19 A G 1: 127,822,680 M978T probably benign Het
Mon1a A C 9: 107,901,363 N262T probably damaging Het
Mpo A G 11: 87,795,881 N85D probably benign Het
Mpp4 T C 1: 59,144,810 D244G probably null Het
Mstn A G 1: 53,066,558 Y353C probably damaging Het
Mx1 T A 16: 97,454,158 N232Y probably damaging Het
Mycs T C X: 5,468,103 R308G probably benign Het
Myh11 A T 16: 14,277,870 D9E probably benign Het
Nfe2l3 A T 6: 51,433,412 Q169L probably null Het
Nr5a1 G T 2: 38,708,419 T122N possibly damaging Het
Nras A G 3: 103,058,979 T20A probably damaging Het
Obp2b T A 2: 25,738,640 probably null Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr1143 T A 2: 87,802,762 F124L probably benign Het
Olfr1410 G A 1: 92,608,400 V188M probably benign Het
Olfr365 A G 2: 37,201,427 Y62C probably damaging Het
Olfr577 T C 7: 102,973,056 N312S probably benign Het
Pcdh17 A T 14: 84,477,654 T920S probably benign Het
Pcdh9 T C 14: 93,887,225 D503G probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pde6b C A 5: 108,388,691 C84* probably null Het
Pex1 A T 5: 3,630,044 N914I probably damaging Het
Pign A G 1: 105,589,317 V528A possibly damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Ppip5k1 T C 2: 121,342,631 K489E probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Radil T C 5: 142,495,336 Y572C probably damaging Het
Rapgef2 A G 3: 79,088,791 I555T possibly damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
Rnaset2b G A 17: 6,981,107 probably null Het
S1pr1 A G 3: 115,711,938 S336P probably benign Het
Slc24a5 A G 2: 125,083,195 E252G possibly damaging Het
Slc34a2 A T 5: 53,061,391 I184F probably benign Het
Slc35a3 A G 3: 116,677,948 V224A possibly damaging Het
Slc39a9 A G 12: 80,677,202 H211R probably damaging Het
Slu7 A G 11: 43,439,268 N174S probably benign Het
Smarcd3 A T 5: 24,595,822 Y131* probably null Het
Syne1 A G 10: 5,367,621 M491T probably benign Het
Tars G A 15: 11,394,243 Q103* probably null Het
Tmem132d C A 5: 127,789,855 E660D probably benign Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T A 2: 76,752,261 M22763L probably benign Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Ubp1 A T 9: 113,955,969 I117L possibly damaging Het
Usp24 T A 4: 106,377,559 H954Q probably benign Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn2r63 G A 7: 42,928,245 Q290* probably null Het
Vnn3 T C 10: 23,865,820 I341T probably benign Het
Wbp2nl A G 15: 82,305,744 T46A probably damaging Het
Wdr48 G T 9: 119,924,247 E625* probably null Het
Wdr6 C T 9: 108,575,164 V507I probably damaging Het
Zp2 A T 7: 120,138,105 W287R probably benign Het
Other mutations in Grn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Grn APN 11 102436258 splice site probably benign
IGL02456:Grn APN 11 102436104 missense probably benign 0.01
PIT4434001:Grn UTSW 11 102435940 missense possibly damaging 0.88
R0395:Grn UTSW 11 102436223 missense probably benign 0.03
R0784:Grn UTSW 11 102434502 missense possibly damaging 0.74
R1037:Grn UTSW 11 102433070 missense possibly damaging 0.94
R1905:Grn UTSW 11 102436450 missense probably damaging 1.00
R3110:Grn UTSW 11 102433243 missense probably benign 0.07
R3111:Grn UTSW 11 102433243 missense probably benign 0.07
R3112:Grn UTSW 11 102433243 missense probably benign 0.07
R3974:Grn UTSW 11 102436339 missense probably damaging 1.00
R4908:Grn UTSW 11 102436518 unclassified probably benign
R4989:Grn UTSW 11 102430554 unclassified probably benign
R5012:Grn UTSW 11 102430554 unclassified probably benign
R5013:Grn UTSW 11 102430554 unclassified probably benign
R5108:Grn UTSW 11 102434402 missense probably benign 0.10
R5133:Grn UTSW 11 102430554 unclassified probably benign
R5134:Grn UTSW 11 102430554 unclassified probably benign
R5162:Grn UTSW 11 102430554 unclassified probably benign
R5182:Grn UTSW 11 102430554 unclassified probably benign
R5183:Grn UTSW 11 102430554 unclassified probably benign
R5308:Grn UTSW 11 102436192 missense possibly damaging 0.96
R5350:Grn UTSW 11 102436244 missense possibly damaging 0.50
R5786:Grn UTSW 11 102434043 nonsense probably null
R6383:Grn UTSW 11 102436795 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGTAACCCTCTTCTGGTGAGTG -3'
(R):5'- GGAAGCAGGATTTCCCATCTGCAC -3'

Sequencing Primer
(F):5'- TGGTGAGTGCCTCCTGC -3'
(R):5'- TCTGCACTACAGTGGAAGC -3'
Posted On2014-05-23