Incidental Mutation 'R1754:Abca2'
ID193808
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission 039786-MU
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1754 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25434333 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 234 (L234M)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably benign
Transcript: ENSMUST00000102919
AA Change: L234M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: L234M

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense probably benign 0.37
R7187:Abca2 UTSW 2 25437721 missense probably damaging 1.00
R7195:Abca2 UTSW 2 25442076 missense probably benign 0.00
R7297:Abca2 UTSW 2 25442076 missense probably benign 0.00
R7487:Abca2 UTSW 2 25437903 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACTCAAGTGCTCCCCAGCATAG -3'
(R):5'- ACCAGCTCATGCAATGCCTGGAAG -3'

Sequencing Primer
(F):5'- GCATAGAGCCAGCACAGTG -3'
(R):5'- GAAGCAGGAGTCTCTCCCATC -3'
Posted On2014-05-23