Incidental Mutation 'R1754:Ssh1'
ID193826
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
MMRRC Submission 039786-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R1754 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113955845 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 276 (I276N)
Ref Sequence ENSEMBL: ENSMUSP00000124312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159592]
Predicted Effect probably damaging
Transcript: ENSMUST00000077689
AA Change: I233N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: I233N

DomainStartEndE-ValueType
Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112298
AA Change: I254N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121
AA Change: I254N

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159592
AA Change: I276N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: I276N

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0682:Ssh1 UTSW 5 113960657 missense probably damaging 1.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R0939:Ssh1 UTSW 5 113970436 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3774:Ssh1 UTSW 5 113966722 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6140:Ssh1 UTSW 5 113942631 missense probably benign 0.16
R6360:Ssh1 UTSW 5 113961347 splice site probably null
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCATCTGGGTTGTACGTGTC -3'
(R):5'- TGCTACCCGTGTCTAAACGCATC -3'

Sequencing Primer
(F):5'- CTGAGCATGGTCCCCAATC -3'
(R):5'- GTGTCTAAACGCATCACCCTG -3'
Posted On2014-05-23