Incidental Mutation 'R1754:Acp4'
ID193839
Institutional Source Beutler Lab
Gene Symbol Acp4
Ensembl Gene ENSMUSG00000012777
Gene Nameacid phosphatase 4
SynonymsEG546967, Acpt
MMRRC Submission 039786-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R1754 (G1)
Quality Score198
Status Not validated
Chromosome7
Chromosomal Location44252148-44257378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44255004 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 212 (I212V)
Ref Sequence ENSEMBL: ENSMUSP00000103578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012921] [ENSMUST00000055858] [ENSMUST00000071296] [ENSMUST00000084937] [ENSMUST00000107945] [ENSMUST00000107948] [ENSMUST00000107949] [ENSMUST00000107950] [ENSMUST00000118216] [ENSMUST00000137702] [ENSMUST00000145653] [ENSMUST00000146155] [ENSMUST00000185481] [ENSMUST00000186606] [ENSMUST00000187524] [ENSMUST00000188111] [ENSMUST00000188382] [ENSMUST00000191537]
Predicted Effect probably benign
Transcript: ENSMUST00000012921
SMART Domains Protein: ENSMUSP00000012921
Gene: ENSMUSG00000012777

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055858
SMART Domains Protein: ENSMUSP00000103583
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071296
SMART Domains Protein: ENSMUSP00000071265
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084937
SMART Domains Protein: ENSMUSP00000095894
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107945
AA Change: I212V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103578
Gene: ENSMUSG00000012777
AA Change: I212V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 324 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107948
SMART Domains Protein: ENSMUSP00000103581
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107949
SMART Domains Protein: ENSMUSP00000103582
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107950
SMART Domains Protein: ENSMUSP00000103584
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117033
Predicted Effect probably benign
Transcript: ENSMUST00000118216
AA Change: I212V

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112922
Gene: ENSMUSG00000012777
AA Change: I212V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125318
Predicted Effect probably benign
Transcript: ENSMUST00000137702
SMART Domains Protein: ENSMUSP00000119445
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138978
Predicted Effect probably benign
Transcript: ENSMUST00000145653
Predicted Effect probably benign
Transcript: ENSMUST00000146155
SMART Domains Protein: ENSMUSP00000117318
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185481
SMART Domains Protein: ENSMUSP00000139913
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186606
SMART Domains Protein: ENSMUSP00000139441
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187524
SMART Domains Protein: ENSMUSP00000140017
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187581
Predicted Effect probably benign
Transcript: ENSMUST00000188111
SMART Domains Protein: ENSMUSP00000139694
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188382
SMART Domains Protein: ENSMUSP00000140200
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188476
Predicted Effect probably benign
Transcript: ENSMUST00000191537
SMART Domains Protein: ENSMUSP00000141077
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acid phosphatases are enzymes capable of hydrolyzing orthophosphoric acid esters in an acid medium. This gene is up-regulated by androgens and is down-regulated by estrogens in the prostate cancer cell line. This gene exhibits a lower level of expression in testicular cancer tissues than in normal tissues. The protein encoded by this gene has structural similarity to prostatic and lysosomal acid phosphatases. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Acp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Acp4 APN 7 44253451 missense possibly damaging 0.56
IGL01067:Acp4 APN 7 44253452 missense probably benign 0.08
IGL01739:Acp4 APN 7 44256786 nonsense probably null
IGL02013:Acp4 APN 7 44255081 missense probably benign 0.13
IGL02225:Acp4 APN 7 44256741 unclassified probably null
IGL02648:Acp4 APN 7 44254990 unclassified probably benign
R0764:Acp4 UTSW 7 44252314 unclassified probably benign
R1328:Acp4 UTSW 7 44257092 splice site probably null
R1411:Acp4 UTSW 7 44256843 unclassified probably benign
R2163:Acp4 UTSW 7 44255976 missense probably damaging 1.00
R2193:Acp4 UTSW 7 44253569 missense probably benign 0.01
R5120:Acp4 UTSW 7 44256971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAGAGATGCCTTGGAATCTGAC -3'
(R):5'- TGTTACGAGAGTCCACAGAGGCAG -3'

Sequencing Primer
(F):5'- ATGCCTTGGAATCTGACATTCG -3'
(R):5'- AGCTGACTACCAGGAGGC -3'
Posted On2014-05-23