Incidental Mutation 'R1754:Nlrp3'
ID193867
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene NameNLR family, pyrin domain containing 3
SynonymsCias1, cryopyrin, Pypaf1, NALP3, Mmig1
MMRRC Submission 039786-MU
Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1754 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59541568-59566956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59558402 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 837 (T837A)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079476
AA Change: T837A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: T837A

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101148
AA Change: T837A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: T837A

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Arid1b A G 17: 5,279,201 probably null Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Flogiston UTSW 11 59558448 missense probably benign 0.00
nd1 UTSW 11 59565974 missense probably benign 0.45
Nd14 UTSW 11 59555875 missense possibly damaging 0.89
Nd3 UTSW 11 59565974 missense probably benign 0.45
nd5 UTSW 11 59565879 missense probably benign 0.01
nd6 UTSW 11 59549354 missense probably damaging 1.00
nd7 UTSW 11 59555875 missense possibly damaging 0.89
Nd9 UTSW 11 59549354 missense probably damaging 1.00
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGTTACTCCTTCAGACGGGGAAGAG -3'
(R):5'- ATGCTGATGCTACGGTTCCCAC -3'

Sequencing Primer
(F):5'- GGATAAGAACTGTGTGGAGCTAAG -3'
(R):5'- ATGCGTGCTTCCCAAATAAG -3'
Posted On2014-05-23