Incidental Mutation 'R1754:Arid1b'
ID193889
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
MMRRC Submission 039786-MU
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R1754 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 5279201 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably null
Transcript: ENSMUST00000092723
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115797
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115799
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000232180
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,321,031 V123A probably damaging Het
Abca2 T A 2: 25,434,333 L234M probably benign Het
Abca3 G A 17: 24,377,779 S402N probably benign Het
Acad12 A T 5: 121,607,481 V249D probably benign Het
Acp4 T C 7: 44,255,004 I212V probably benign Het
Actl6a T A 3: 32,718,574 V233D probably damaging Het
Aire T A 10: 78,030,290 Q533L probably damaging Het
Aldh3b3 T C 19: 3,968,517 S411P probably benign Het
Amer2 A G 14: 60,379,757 K467R probably damaging Het
Apol9b A T 15: 77,735,762 I253F probably benign Het
Atp6v0a4 T C 6: 38,067,829 T494A probably benign Het
Atp6v1b2 A G 8: 69,101,961 D106G probably benign Het
Avpr1b T C 1: 131,600,101 S121P probably damaging Het
Bcl11a A C 11: 24,164,724 E689A probably damaging Het
Brpf3 T G 17: 28,821,323 L906R probably benign Het
Btn1a1 T C 13: 23,460,468 K287E probably benign Het
Cacna1i A G 15: 80,371,529 H871R probably damaging Het
Cd14 A T 18: 36,725,514 L296Q probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 G T 8: 71,623,179 W490L probably damaging Het
Ctnna2 A G 6: 77,636,749 I273T possibly damaging Het
Dnah7a A T 1: 53,504,185 D2275E probably benign Het
Dnah7a A C 1: 53,561,900 probably null Het
Egfem1 T C 3: 29,668,333 Y404H possibly damaging Het
Esm1 A T 13: 113,216,696 N171Y probably damaging Het
Exoc1 T G 5: 76,560,322 probably null Het
Fcho1 A G 8: 71,711,246 I580T probably benign Het
Fgfr1 A G 8: 25,570,210 H552R probably damaging Het
Fsbp A G 4: 11,583,906 R202G probably damaging Het
Gabra6 A G 11: 42,316,561 V231A probably damaging Het
Gm8765 A T 13: 50,701,087 T254S probably damaging Het
Gmeb1 A G 4: 132,232,027 S239P probably benign Het
Gnpat T A 8: 124,877,006 Y208N probably damaging Het
Il21 T C 3: 37,225,525 K114R possibly damaging Het
Inhbc T C 10: 127,370,293 D35G possibly damaging Het
Inpp4b A T 8: 81,770,811 T87S probably damaging Het
Kcns2 T C 15: 34,839,517 I342T possibly damaging Het
Ky A T 9: 102,541,927 T378S possibly damaging Het
Lcat CAT C 8: 105,941,814 probably null Het
Lrrc8d T C 5: 105,812,657 V311A probably benign Het
Mief1 A G 15: 80,249,602 I287V probably damaging Het
Mrpl47 A G 3: 32,730,084 V179A probably benign Het
Mtcl1 T C 17: 66,380,183 K576R probably damaging Het
Myh10 C A 11: 68,813,058 A1902E probably damaging Het
Nlrp3 A G 11: 59,558,402 T837A possibly damaging Het
Nr1i3 T C 1: 171,217,394 Y132H probably damaging Het
Oit3 T C 10: 59,427,940 probably null Het
Olfr1186 A T 2: 88,525,815 R77S probably damaging Het
Olfr1467 T C 19: 13,365,353 S242P probably damaging Het
Olfr193 T A 16: 59,110,581 I10F probably benign Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Olfr427 A G 1: 174,100,033 T192A probably benign Het
Olfr533 A T 7: 140,466,860 I220F probably damaging Het
Olfr8 T A 10: 78,955,697 V164E probably damaging Het
Olfr825 G A 10: 130,163,164 T54I probably benign Het
Pdlim4 T C 11: 54,055,873 E196G possibly damaging Het
Pigs A G 11: 78,337,847 Y293C probably damaging Het
Pkd1l2 A T 8: 117,030,719 S1527T possibly damaging Het
Pkd2l1 A T 19: 44,155,601 Y344* probably null Het
Pmp2 T C 3: 10,182,224 probably null Het
Polr3e T C 7: 120,939,298 probably null Het
Ppp3ca C G 3: 136,881,448 I230M probably benign Het
Ppp5c T C 7: 17,005,310 H463R probably benign Het
Ptger1 A G 8: 83,669,297 N328D probably benign Het
Rhno1 A T 6: 128,357,859 I167N probably benign Het
Rictor C A 15: 6,735,368 P34H probably damaging Het
Rnf10 A C 5: 115,245,865 S630R probably damaging Het
Rnf168 A G 16: 32,299,124 Q501R probably benign Het
Rngtt T G 4: 33,329,634 probably null Het
Samd9l G T 6: 3,373,126 F1378L probably damaging Het
Slc9c1 T A 16: 45,589,509 M864K probably benign Het
Slitrk5 T C 14: 111,680,519 F525S probably damaging Het
Sox6 T C 7: 115,477,055 M784V probably benign Het
Spint2 C T 7: 29,260,366 probably null Het
Ssh1 A T 5: 113,955,845 I276N probably damaging Het
Trank1 T A 9: 111,392,871 V2892D probably benign Het
Ttn C A 2: 76,751,040 E21424* probably null Het
Usp17lc T C 7: 103,418,848 I450T probably benign Het
Vcan A G 13: 89,704,735 V702A probably benign Het
Vmn1r36 TA TAA 6: 66,716,533 probably null Het
Vmn2r51 G T 7: 10,099,946 D388E probably benign Het
Zfp106 G A 2: 120,533,763 S721L probably damaging Het
Zfp106 A C 2: 120,533,764 S721A probably damaging Het
Zfp189 T A 4: 49,529,342 H148Q possibly damaging Het
Zfp352 A T 4: 90,223,809 Y62F probably benign Het
Zfp839 T C 12: 110,855,457 V235A probably damaging Het
Zfp871 T C 17: 32,775,334 Y289C probably damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAAGGTGACCTCATGCTGACTG -3'
(R):5'- CCTCCCACCATGCATTTTGGAGAAC -3'

Sequencing Primer
(F):5'- TCAAGGCCACTGACTATTGG -3'
(R):5'- GAGAACGTCTTGCTTTGTTACC -3'
Posted On2014-05-23