Incidental Mutation 'R1745:N4bp2l2'
ID193916
Institutional Source Beutler Lab
Gene Symbol N4bp2l2
Ensembl Gene ENSMUSG00000029655
Gene NameNEDD4 binding protein 2-like 2
Synonymszag1, 2700092H06Rik
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R1745 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150608007-150666183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150661959 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 185 (N185K)
Ref Sequence ENSEMBL: ENSMUSP00000113895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118316] [ENSMUST00000141857] [ENSMUST00000156180]
Predicted Effect probably benign
Transcript: ENSMUST00000118316
AA Change: N185K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113895
Gene: ENSMUSG00000029655
AA Change: N185K

DomainStartEndE-ValueType
low complexity region 128 139 N/A INTRINSIC
coiled coil region 161 194 N/A INTRINSIC
Pfam:Zeta_toxin 380 498 1.3e-7 PFAM
Pfam:AAA_33 396 530 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144378
Predicted Effect probably benign
Transcript: ENSMUST00000156180
SMART Domains Protein: ENSMUSP00000118475
Gene: ENSMUSG00000029655

DomainStartEndE-ValueType
SCOP:d3aky_1 53 134 1e-5 SMART
Blast:AAA 61 120 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201390
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in N4bp2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:N4bp2l2 APN 5 150661936 missense probably benign 0.23
IGL03022:N4bp2l2 APN 5 150643296 missense probably benign 0.37
IGL03234:N4bp2l2 APN 5 150650726 nonsense probably null
IGL03274:N4bp2l2 APN 5 150661466 missense probably damaging 0.99
R0723:N4bp2l2 UTSW 5 150662432 missense probably damaging 1.00
R1994:N4bp2l2 UTSW 5 150661283 missense possibly damaging 0.81
R2141:N4bp2l2 UTSW 5 150647536 missense probably damaging 1.00
R2201:N4bp2l2 UTSW 5 150661608 missense probably damaging 0.98
R4662:N4bp2l2 UTSW 5 150650695 missense probably damaging 1.00
R4854:N4bp2l2 UTSW 5 150662051 missense probably benign 0.27
R4932:N4bp2l2 UTSW 5 150643141 missense probably benign 0.30
R5572:N4bp2l2 UTSW 5 150662290 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGCAGGCATCAACTGCTCATCAC -3'
(R):5'- TGCAGGATGGAAAGCCTTCACCAC -3'

Sequencing Primer
(F):5'- CATCACAGGGATAGTCTGGTTCATC -3'
(R):5'- AGCATTCATAGGCCCCATTTAC -3'
Posted On2014-05-23