Incidental Mutation 'R1745:4931440F15Rik'
ID193938
Institutional Source Beutler Lab
Gene Symbol 4931440F15Rik
Ensembl Gene ENSMUSG00000078157
Gene NameRIKEN cDNA 4931440F15 gene
Synonyms
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1745 (G1)
Quality Score214
Status Validated
Chromosome11
Chromosomal Location29822395-29825668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29824723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 245 (S245P)
Ref Sequence ENSEMBL: ENSMUSP00000100568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000104962]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104962
AA Change: S245P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100568
Gene: ENSMUSG00000078157
AA Change: S245P

DomainStartEndE-ValueType
ANK 19 50 1.53e3 SMART
ANK 57 87 1.7e-3 SMART
ANK 99 128 3.6e-2 SMART
ANK 132 162 3.31e-1 SMART
ANK 166 195 8.19e-6 SMART
ANK 199 228 7.83e-3 SMART
ANK 231 260 1.8e-2 SMART
low complexity region 297 306 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
ANK 536 578 8.39e-3 SMART
ANK 582 611 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109452
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Nkx2-1 A G 12: 56,533,744 M137T probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in 4931440F15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:4931440F15Rik APN 11 29824755 missense probably damaging 1.00
IGL01560:4931440F15Rik APN 11 29824643 nonsense probably null
IGL02160:4931440F15Rik APN 11 29823593 nonsense probably null
IGL03058:4931440F15Rik APN 11 29824656 missense probably benign 0.01
IGL03107:4931440F15Rik APN 11 29824360 missense probably damaging 1.00
R0504:4931440F15Rik UTSW 11 29824990 missense probably damaging 1.00
R0615:4931440F15Rik UTSW 11 29824515 missense probably damaging 1.00
R1167:4931440F15Rik UTSW 11 29823567 missense probably damaging 1.00
R1329:4931440F15Rik UTSW 11 29823553 missense probably benign 0.01
R1525:4931440F15Rik UTSW 11 29823994 missense probably benign 0.11
R1917:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R1918:4931440F15Rik UTSW 11 29824039 missense probably benign 0.00
R2338:4931440F15Rik UTSW 11 29823718 missense probably benign 0.01
R4359:4931440F15Rik UTSW 11 29824669 missense probably benign 0.12
R4757:4931440F15Rik UTSW 11 29825454 start codon destroyed probably null 1.00
R4859:4931440F15Rik UTSW 11 29825178 missense probably damaging 1.00
R5595:4931440F15Rik UTSW 11 29824288 missense probably benign 0.00
Z1088:4931440F15Rik UTSW 11 29825007 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATTCTCTCCCGTATCAGCAGC -3'
(R):5'- AATCTGGCAGCCTGGAGATCCTAC -3'

Sequencing Primer
(F):5'- AACTCTTGAGGCGTAGTCAC -3'
(R):5'- GAGATCCTACAACTGCTGCTGAG -3'
Posted On2014-05-23