Incidental Mutation 'R1745:Nkx2-1'
ID193943
Institutional Source Beutler Lab
Gene Symbol Nkx2-1
Ensembl Gene ENSMUSG00000001496
Gene NameNK2 homeobox 1
Synonymsthyroid-specific enhancer-binding protein, Titf1, tinman, thyroid transcription factor-1, T/EBP, Ttf-1
MMRRC Submission 039777-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1745 (G1)
Quality Score102
Status Validated
Chromosome12
Chromosomal Location56531958-56536908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56533744 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 137 (M137T)
Ref Sequence ENSEMBL: ENSMUSP00000136103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001536] [ENSMUST00000178477]
Predicted Effect probably benign
Transcript: ENSMUST00000001536
AA Change: M137T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001536
Gene: ENSMUSG00000001496
AA Change: M137T

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
HOX 161 223 9.05e-25 SMART
low complexity region 224 254 N/A INTRINSIC
low complexity region 273 323 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178477
AA Change: M137T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136103
Gene: ENSMUSG00000001496
AA Change: M137T

DomainStartEndE-ValueType
low complexity region 39 69 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
HOX 161 223 9.05e-25 SMART
low complexity region 224 254 N/A INTRINSIC
low complexity region 273 323 N/A INTRINSIC
low complexity region 346 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220379
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein initially identified as a thyroid-specific transcription factor. The encoded protein binds to the thyroglobulin promoter and regulates the expression of thyroid-specific genes but has also been shown to regulate the expression of genes involved in morphogenesis. Mutations and deletions in this gene are associated with benign hereditary chorea, choreoathetosis, congenital hypothyroidism, and neonatal respiratory distress, and may be associated with thyroid cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares the symbol/alias 'TTF1' with another gene, transcription termination factor 1, which plays a role in ribosomal gene transcription. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted mutation have profoundly abnormal lungs and ventral forebrain defects, lack thyroids, pituitary gland, and tracheoesophageal septation, and die at birth from respiratory failure. Carriers show incoordination and high TSH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,723 S245P probably benign Het
Abcc10 A T 17: 46,312,433 V851E probably benign Het
Adam28 A G 14: 68,633,171 I351T probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ap2a1 T C 7: 44,906,945 E285G probably damaging Het
Arfgef1 A C 1: 10,173,255 I1023R probably damaging Het
Atp2c2 G A 8: 119,725,094 V133I probably benign Het
Bpifb6 A G 2: 153,911,483 T401A possibly damaging Het
Capn3 G A 2: 120,489,689 V283M possibly damaging Het
Chd6 A T 2: 160,981,667 V1261E probably damaging Het
Col22a1 C T 15: 72,006,787 A174T probably damaging Het
Crnn T C 3: 93,146,891 V27A probably benign Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dgkd T C 1: 87,932,044 probably null Het
Diaph3 A G 14: 86,966,560 L554P probably damaging Het
Ephb4 A T 5: 137,360,434 H293L probably benign Het
Erbin G T 13: 103,839,449 H646N probably damaging Het
Faiml T C 9: 99,234,458 N60D probably benign Het
Flot1 A G 17: 35,824,660 E102G probably damaging Het
Fryl G A 5: 73,032,861 probably benign Het
Gad1-ps A T 10: 99,445,524 noncoding transcript Het
Gtf3c3 A G 1: 54,434,212 S81P probably damaging Het
Hs1bp3 C T 12: 8,321,690 Q91* probably null Het
Igf1r T C 7: 68,169,913 C324R probably damaging Het
Il23r G A 6: 67,466,291 T276I probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kctd1 A T 18: 15,063,206 probably benign Het
Kmt2b A T 7: 30,585,850 M539K possibly damaging Het
Man2b1 T A 8: 85,093,934 F617I probably damaging Het
Med15 G A 16: 17,655,706 probably benign Het
Myo9b A G 8: 71,354,047 K1543R probably damaging Het
N4bp2 A G 5: 65,790,822 Y265C probably benign Het
N4bp2l2 A T 5: 150,661,959 N185K probably benign Het
Olfr638 A G 7: 104,004,063 T269A probably benign Het
Prickle2 A T 6: 92,376,593 Y631N probably damaging Het
Ptpro A G 6: 137,400,645 T698A probably benign Het
Rapgef3 T C 15: 97,750,178 I690V probably benign Het
Rnf44 G A 13: 54,682,192 R271W probably damaging Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Ryr2 A G 13: 11,790,267 Y904H probably damaging Het
Suz12 T C 11: 80,022,096 L322P probably damaging Het
Tnfsf13 G A 11: 69,685,147 A38V probably benign Het
Topbp1 G A 9: 103,308,845 R62H probably benign Het
Tor1aip1 G T 1: 156,030,434 probably null Het
Trpv4 A T 5: 114,633,154 V438E probably damaging Het
Tsku A T 7: 98,352,179 V315E possibly damaging Het
Ttc38 T C 15: 85,833,172 L16P probably damaging Het
Vmn1r170 A G 7: 23,606,334 I54V probably damaging Het
Vmn1r71 T C 7: 10,748,269 D98G probably benign Het
Wdfy3 A T 5: 101,948,929 D334E probably damaging Het
Zfhx3 T A 8: 108,955,862 F3311Y unknown Het
Zswim9 A G 7: 13,269,556 S123P probably damaging Het
Other mutations in Nkx2-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0617:Nkx2-1 UTSW 12 56534855 missense possibly damaging 0.75
R2209:Nkx2-1 UTSW 12 56533508 missense probably benign 0.15
R2230:Nkx2-1 UTSW 12 56533286 nonsense probably null
R4691:Nkx2-1 UTSW 12 56533565 missense probably benign 0.01
R4990:Nkx2-1 UTSW 12 56534939 missense possibly damaging 0.72
R4991:Nkx2-1 UTSW 12 56534939 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCTGGAACCAGATCTTGACCTGCG -3'
(R):5'- TTAAGTAGTTCGACGGCACGGC -3'

Sequencing Primer
(F):5'- GTGTCAGGTGAATCATGCTG -3'
(R):5'- AGCTGGGCCTCTTTTGGG -3'
Posted On2014-05-23