Incidental Mutation 'R1746:Gulp1'
ID193956
Institutional Source Beutler Lab
Gene Symbol Gulp1
Ensembl Gene ENSMUSG00000056870
Gene NameGULP, engulfment adaptor PTB domain containing 1
Synonyms3110030A04Rik, GULP, CED-6, Ced6, 5730529O06Rik
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location44551511-44796838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44754353 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 58 (H58R)
Ref Sequence ENSEMBL: ENSMUSP00000124756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074525] [ENSMUST00000159555] [ENSMUST00000160854] [ENSMUST00000162600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074525
AA Change: H58R

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074115
Gene: ENSMUSG00000056870
AA Change: H58R

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 159 202 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000159555
Predicted Effect possibly damaging
Transcript: ENSMUST00000160854
AA Change: H58R

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125506
Gene: ENSMUSG00000056870
AA Change: H58R

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 159 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161793
Predicted Effect possibly damaging
Transcript: ENSMUST00000162600
AA Change: H58R

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124756
Gene: ENSMUSG00000056870
AA Change: H58R

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 178 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194594
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Gulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Gulp1 APN 1 44744548 splice site probably benign
IGL02439:Gulp1 APN 1 44781004 missense probably damaging 0.96
IGL03410:Gulp1 APN 1 44708617 missense probably damaging 0.97
guzzle UTSW 1 44708669 nonsense probably null
R1990:Gulp1 UTSW 1 44766114 missense possibly damaging 0.92
R4166:Gulp1 UTSW 1 44708669 nonsense probably null
R4895:Gulp1 UTSW 1 44788597 missense probably benign
R5208:Gulp1 UTSW 1 44781039 missense probably benign 0.00
R5244:Gulp1 UTSW 1 44788453 missense probably damaging 1.00
R5533:Gulp1 UTSW 1 44773281 missense probably damaging 1.00
R5911:Gulp1 UTSW 1 44754374 missense possibly damaging 0.55
R6164:Gulp1 UTSW 1 44754351 missense probably damaging 0.98
R6503:Gulp1 UTSW 1 44773380 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGACGGTTACTGAGCAAAGCTA -3'
(R):5'- CCAAAGGCTGTTACCTTTCCCCAAA -3'

Sequencing Primer
(F):5'- CGGTTACTGAGCAAAGCTATTTTATG -3'
(R):5'- ACCAAGAACCAACCATTTTAAGTTAG -3'
Posted On2014-05-23