Incidental Mutation 'R1746:Arhgap21'
ID193959
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20861099 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 902 (E902G)
Ref Sequence ENSEMBL: ENSMUSP00000133347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000173784] [ENSMUST00000174584]
Predicted Effect probably damaging
Transcript: ENSMUST00000114594
AA Change: E1067G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: E1067G

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127512
Predicted Effect possibly damaging
Transcript: ENSMUST00000141298
AA Change: E1073G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: E1073G

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154230
AA Change: E1073G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: E1073G

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154657
Predicted Effect probably damaging
Transcript: ENSMUST00000173194
AA Change: E1063G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: E1063G

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173784
AA Change: E178G

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133539
Gene: ENSMUSG00000036591
AA Change: E178G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
PH 40 150 2.09e-16 SMART
RhoGAP 268 395 1.55e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174584
AA Change: E902G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: E902G

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174825
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACTGCTCGTAACAATAGCACAGG -3'
(R):5'- AATTGGGCCATCCCCACTGAGAAC -3'

Sequencing Primer
(F):5'- TCGTAACAATAGCACAGGAAAGC -3'
(R):5'- TGGTTCAGTAGCAAGCCTC -3'
Posted On2014-05-23