Incidental Mutation 'R1746:Dclk2'
ID193969
Institutional Source Beutler Lab
Gene Symbol Dclk2
Ensembl Gene ENSMUSG00000028078
Gene Namedoublecortin-like kinase 2
SynonymsDcamkl2, Click-II, 6330415M09Rik
MMRRC Submission 039778-MU
Accession Numbers

Genbank: NM_027539; MGI: 1918012

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86786151-86920852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86805639 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 503 (R503Q)
Ref Sequence ENSEMBL: ENSMUSP00000141707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000194452] [ENSMUST00000195561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029719
AA Change: R503Q

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078
AA Change: R503Q

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 650 4.96e-101 SMART
low complexity region 718 740 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191752
AA Change: R503Q

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078
AA Change: R503Q

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 646 2.4e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192773
AA Change: R502Q

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078
AA Change: R502Q

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 641 8.6e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193632
AA Change: R519Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078
AA Change: R519Q

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194452
AA Change: R502Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078
AA Change: R502Q

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
Pfam:Pkinase_Tyr 392 590 2.2e-31 PFAM
Pfam:Pkinase 392 591 4.7e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195561
AA Change: R502Q

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078
AA Change: R502Q

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 649 4.96e-101 SMART
low complexity region 717 739 N/A INTRINSIC
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Dclk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dclk2 APN 3 86799090 critical splice acceptor site probably null
IGL01769:Dclk2 APN 3 86816360 missense possibly damaging 0.50
IGL01802:Dclk2 APN 3 86799027 missense probably damaging 1.00
IGL02296:Dclk2 APN 3 86793293 missense probably damaging 1.00
IGL02390:Dclk2 APN 3 86824683 missense probably damaging 0.99
IGL02522:Dclk2 APN 3 86920116 missense probably benign 0.01
IGL03104:Dclk2 APN 3 86836359 missense probably damaging 1.00
IGL03337:Dclk2 APN 3 86906059 missense probably damaging 1.00
R0219:Dclk2 UTSW 3 86813669 splice site probably benign
R0400:Dclk2 UTSW 3 86813747 splice site probably null
R0606:Dclk2 UTSW 3 86906004 missense probably damaging 1.00
R1537:Dclk2 UTSW 3 86806184 missense probably damaging 0.97
R1569:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1571:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1612:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1680:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1689:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1714:Dclk2 UTSW 3 86906093 missense probably benign 0.00
R1745:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1752:Dclk2 UTSW 3 86806127 missense possibly damaging 0.61
R1829:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2008:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2125:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2126:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2132:Dclk2 UTSW 3 86920046 missense probably benign 0.44
R2314:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2338:Dclk2 UTSW 3 86799017 missense probably damaging 1.00
R2849:Dclk2 UTSW 3 86793223 missense probably damaging 1.00
R3108:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3109:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3615:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3616:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R4051:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4052:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4208:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4643:Dclk2 UTSW 3 86806180 missense possibly damaging 0.93
R4654:Dclk2 UTSW 3 86836376 missense probably damaging 1.00
R4693:Dclk2 UTSW 3 86815093 missense possibly damaging 0.67
R4716:Dclk2 UTSW 3 86919881 missense probably damaging 1.00
R4914:Dclk2 UTSW 3 86824742 splice site probably null
R4915:Dclk2 UTSW 3 86824742 splice site probably null
R4917:Dclk2 UTSW 3 86824742 splice site probably null
R5218:Dclk2 UTSW 3 86805678 missense probably damaging 1.00
R5510:Dclk2 UTSW 3 86906037 missense possibly damaging 0.93
R5520:Dclk2 UTSW 3 86919840 missense probably damaging 1.00
R5867:Dclk2 UTSW 3 86791859 makesense probably null
R5976:Dclk2 UTSW 3 86787225 missense possibly damaging 0.53
R6048:Dclk2 UTSW 3 86905965 missense probably damaging 1.00
R6111:Dclk2 UTSW 3 86805661 missense probably benign 0.28
R6192:Dclk2 UTSW 3 86815150 missense probably damaging 1.00
R6289:Dclk2 UTSW 3 86831817 missense probably benign 0.18
R6595:Dclk2 UTSW 3 86792067 critical splice donor site probably benign
R6897:Dclk2 UTSW 3 86831763 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTATGCACTGATTCAAGATGCCC -3'
(R):5'- TCTGCAAACTGATGTGACACCCTTC -3'

Sequencing Primer
(F):5'- CACTGATTCAAGATGCCCATTAGG -3'
(R):5'- CTTCTTATTTCAGAGGACCGAACTG -3'
Posted On2014-05-23