Incidental Mutation 'R1746:Fnbp1l'
ID193971
Institutional Source Beutler Lab
Gene Symbol Fnbp1l
Ensembl Gene ENSMUSG00000039735
Gene Nameformin binding protein 1-like
SynonymsTOCA1, 2610318I01Rik
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122538719-122619715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122556491 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 357 (I357T)
Ref Sequence ENSEMBL: ENSMUSP00000124947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162409] [ENSMUST00000162947]
Predicted Effect probably benign
Transcript: ENSMUST00000162409
SMART Domains Protein: ENSMUSP00000124439
Gene: ENSMUSG00000039735

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
PDB:2KE4|A 331 426 3e-30 PDB
low complexity region 468 477 N/A INTRINSIC
SH3 483 540 5.27e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162884
Predicted Effect probably benign
Transcript: ENSMUST00000162947
AA Change: I357T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124947
Gene: ENSMUSG00000039735
AA Change: I357T

DomainStartEndE-ValueType
FCH 1 93 4.83e-18 SMART
coiled coil region 131 177 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
PDB:2KE4|A 389 484 4e-30 PDB
low complexity region 526 535 N/A INTRINSIC
SH3 541 598 5.27e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000197259
AA Change: I202T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197342
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Fnbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Fnbp1l APN 3 122549249 missense possibly damaging 0.81
IGL01655:Fnbp1l APN 3 122568749 splice site probably null
IGL01750:Fnbp1l APN 3 122544677 nonsense probably null
IGL02040:Fnbp1l APN 3 122570953 splice site probably benign
IGL02187:Fnbp1l APN 3 122568800 nonsense probably null
IGL03334:Fnbp1l APN 3 122557949 missense probably benign 0.00
R0347:Fnbp1l UTSW 3 122590175 missense probably damaging 1.00
R0382:Fnbp1l UTSW 3 122570953 splice site probably benign
R1401:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R1778:Fnbp1l UTSW 3 122590147 missense possibly damaging 0.89
R1861:Fnbp1l UTSW 3 122560932 missense probably damaging 1.00
R2202:Fnbp1l UTSW 3 122546962 missense probably benign 0.00
R3407:Fnbp1l UTSW 3 122552150 missense probably damaging 1.00
R3434:Fnbp1l UTSW 3 122546306 missense probably damaging 0.97
R3947:Fnbp1l UTSW 3 122544579 missense possibly damaging 0.78
R4667:Fnbp1l UTSW 3 122556567 missense probably benign 0.04
R4771:Fnbp1l UTSW 3 122558103 missense possibly damaging 0.54
R4858:Fnbp1l UTSW 3 122546315 missense probably benign 0.30
R5163:Fnbp1l UTSW 3 122544663 missense probably benign 0.00
R6151:Fnbp1l UTSW 3 122570930 missense possibly damaging 0.89
R6153:Fnbp1l UTSW 3 122559156 missense probably benign 0.01
R6452:Fnbp1l UTSW 3 122544549 missense probably damaging 1.00
R6458:Fnbp1l UTSW 3 122556440 missense probably damaging 0.96
R6788:Fnbp1l UTSW 3 122546307 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGAGTATTGAAAAGCCACACTACAC -3'
(R):5'- CTCTTGGTCACAGCAGAGGAGC -3'

Sequencing Primer
(F):5'- CACACAATTAGGCCATCATGC -3'
(R):5'- GCACATTTGGCTTATTGATTCCTTT -3'
Posted On2014-05-23