Incidental Mutation 'R1746:Fggy'
ID193973
Institutional Source Beutler Lab
Gene Symbol Fggy
Ensembl Gene ENSMUSG00000028573
Gene NameFGGY carbohydrate kinase domain containing
Synonyms2310009E04Rik
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location95557507-95926939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95926728 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 440 (Y440C)
Ref Sequence ENSEMBL: ENSMUSP00000102706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079223] [ENSMUST00000107091] [ENSMUST00000130541]
Predicted Effect probably damaging
Transcript: ENSMUST00000079223
AA Change: Y528C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078216
Gene: ENSMUSG00000028573
AA Change: Y528C

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 3.3e-27 PFAM
Pfam:FGGY_C 290 498 1.1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107091
AA Change: Y440C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102706
Gene: ENSMUSG00000028573
AA Change: Y440C

DomainStartEndE-ValueType
Pfam:FGGY_N 12 78 1.7e-10 PFAM
Pfam:FGGY_C 202 410 1.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130541
SMART Domains Protein: ENSMUSP00000115688
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_C 1 150 3.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141248
Predicted Effect probably benign
Transcript: ENSMUST00000142384
Predicted Effect probably benign
Transcript: ENSMUST00000156223
SMART Domains Protein: ENSMUSP00000118147
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_C 6 124 8.5e-26 PFAM
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Fggy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Fggy APN 4 95837628 missense possibly damaging 0.86
IGL02377:Fggy APN 4 95623477 unclassified probably benign
IGL02417:Fggy APN 4 95849609 missense probably benign 0.01
IGL02527:Fggy APN 4 95697069 missense probably damaging 1.00
IGL02967:Fggy APN 4 95926749 missense possibly damaging 0.74
IGL03053:Fggy APN 4 95926809 unclassified probably benign
IGL03168:Fggy APN 4 95926809 unclassified probably benign
IGL03370:Fggy APN 4 95822064 missense probably damaging 1.00
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0312:Fggy UTSW 4 95844185 missense probably damaging 1.00
R0520:Fggy UTSW 4 95601103 missense probably damaging 1.00
R0747:Fggy UTSW 4 95812100 splice site probably benign
R0940:Fggy UTSW 4 95697001 missense probably benign 0.40
R1513:Fggy UTSW 4 95902058 intron probably benign
R2998:Fggy UTSW 4 95849585 missense probably benign 0.01
R3848:Fggy UTSW 4 95601124 unclassified probably benign
R4913:Fggy UTSW 4 95697076 critical splice donor site probably null
R5458:Fggy UTSW 4 95926743 missense probably benign
R5868:Fggy UTSW 4 95696988 missense probably damaging 0.99
R6583:Fggy UTSW 4 95600973 missense probably benign 0.01
R6589:Fggy UTSW 4 95597638 missense probably benign 0.00
X0067:Fggy UTSW 4 95696992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTATTCCACTTTGGATGCAC -3'
(R):5'- TGCCAAAATTATACCCAAGGGGCAC -3'

Sequencing Primer
(F):5'- GGATGCACCTTGCTGATAAAAC -3'
(R):5'- GCACTGAGCATAAGATGAACAC -3'
Posted On2014-05-23