Incidental Mutation 'R1746:Tet3'
ID193976
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Nametet methylcytosine dioxygenase 3
SynonymsD230004J03Rik, B430006D22Rik
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83362373-83459084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83368068 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1796 (T1796A)
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548]
Predicted Effect probably damaging
Transcript: ENSMUST00000089622
AA Change: T1661A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: T1661A

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186548
AA Change: T1796A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: T1796A

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83368655 missense probably benign 0.06
IGL01396:Tet3 APN 6 83369638 nonsense probably null
IGL02344:Tet3 APN 6 83403833 missense probably benign 0.04
IGL02987:Tet3 APN 6 83368092 missense probably damaging 0.99
IGL03126:Tet3 APN 6 83376787 missense probably damaging 1.00
IGL03155:Tet3 APN 6 83368383 missense probably damaging 1.00
IGL03286:Tet3 APN 6 83375778 missense probably damaging 1.00
Reedy UTSW 6 83368084 nonsense probably null
P0033:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R0131:Tet3 UTSW 6 83368788 missense probably damaging 1.00
R0295:Tet3 UTSW 6 83369139 missense probably benign 0.14
R0504:Tet3 UTSW 6 83373794 missense probably damaging 1.00
R0524:Tet3 UTSW 6 83379942 missense probably damaging 1.00
R1061:Tet3 UTSW 6 83373323 missense probably damaging 0.99
R1160:Tet3 UTSW 6 83404452 missense probably benign 0.00
R1550:Tet3 UTSW 6 83386028 missense probably damaging 0.97
R1640:Tet3 UTSW 6 83369315 missense probably benign 0.44
R1658:Tet3 UTSW 6 83369057 missense probably benign 0.44
R1761:Tet3 UTSW 6 83403659 missense probably damaging 0.99
R1832:Tet3 UTSW 6 83403645 missense probably benign
R1835:Tet3 UTSW 6 83404163 missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83404379 missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83386075 missense probably damaging 1.00
R2230:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2232:Tet3 UTSW 6 83369471 missense probably damaging 1.00
R2922:Tet3 UTSW 6 83368512 missense probably damaging 1.00
R3429:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R3430:Tet3 UTSW 6 83403419 missense probably damaging 1.00
R4291:Tet3 UTSW 6 83373199 missense probably damaging 1.00
R4349:Tet3 UTSW 6 83403275 missense probably benign
R4809:Tet3 UTSW 6 83402946 missense probably benign
R4846:Tet3 UTSW 6 83376883 nonsense probably null
R5039:Tet3 UTSW 6 83375896 missense probably damaging 1.00
R5233:Tet3 UTSW 6 83386063 missense probably damaging 1.00
R5363:Tet3 UTSW 6 83376764 critical splice donor site probably null
R5880:Tet3 UTSW 6 83370550 missense probably damaging 1.00
R6270:Tet3 UTSW 6 83375791 missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83368084 nonsense probably null
R6564:Tet3 UTSW 6 83386070 missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83403444 missense probably benign 0.00
X0004:Tet3 UTSW 6 83403423 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AATCACCCGACAGCCGTAGTTTC -3'
(R):5'- CTCGCTGGTCTTCTACCAACACAAG -3'

Sequencing Primer
(F):5'- CGACAGCCGTAGTTTCTTCAAAG -3'
(R):5'- GCTCTGGGAGGCCAAGATG -3'
Posted On2014-05-23