Incidental Mutation 'R1746:Olfr472'
ID193982
Institutional Source Beutler Lab
Gene Symbol Olfr472
Ensembl Gene ENSMUSG00000073893
Gene Nameolfactory receptor 472
SynonymsMOR204-5, GA_x6K02T2PBJ9-10231953-10232885
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107897902-107907762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107902886 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 56 (H56Q)
Ref Sequence ENSEMBL: ENSMUSP00000150404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000209670] [ENSMUST00000210420] [ENSMUST00000216937]
Predicted Effect probably benign
Transcript: ENSMUST00000084760
AA Change: H56Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081815
Gene: ENSMUSG00000063120
AA Change: H56Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-49 PFAM
Pfam:7tm_1 41 290 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209670
AA Change: H56Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000210420
AA Change: H56Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210856
AA Change: H56Q
Predicted Effect probably benign
Transcript: ENSMUST00000216937
AA Change: H56Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Olfr472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Olfr472 APN 7 107903104 missense probably damaging 1.00
IGL02002:Olfr472 APN 7 107903290 missense possibly damaging 0.81
IGL02320:Olfr472 APN 7 107902831 missense possibly damaging 0.78
IGL02701:Olfr472 APN 7 107903442 missense probably benign 0.42
IGL03022:Olfr472 APN 7 107902981 missense probably benign 0.18
IGL03214:Olfr472 APN 7 107902966 missense probably benign 0.00
IGL03257:Olfr472 APN 7 107902756 missense probably benign 0.01
IGL03372:Olfr472 APN 7 107903370 missense probably damaging 1.00
R0081:Olfr472 UTSW 7 107903005 missense probably benign 0.00
R0669:Olfr472 UTSW 7 107903239 missense probably damaging 1.00
R0932:Olfr472 UTSW 7 107903190 missense possibly damaging 0.94
R1158:Olfr472 UTSW 7 107902923 missense possibly damaging 0.75
R3777:Olfr472 UTSW 7 107902747 missense probably benign
R3778:Olfr472 UTSW 7 107902747 missense probably benign
R4605:Olfr472 UTSW 7 107903238 missense probably benign 0.24
R4661:Olfr472 UTSW 7 107902981 missense probably benign 0.18
R4675:Olfr472 UTSW 7 107903360 missense probably damaging 1.00
R5374:Olfr472 UTSW 7 107903491 missense possibly damaging 0.52
R5686:Olfr472 UTSW 7 107902912 missense probably damaging 0.99
R6030:Olfr472 UTSW 7 107903413 missense probably benign 0.06
R6030:Olfr472 UTSW 7 107903413 missense probably benign 0.06
R6164:Olfr472 UTSW 7 107903388 missense probably benign 0.01
R6347:Olfr472 UTSW 7 107902950 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCATACCACTGTGGCAGAGCTAATC -3'
(R):5'- ACACTTTCAGCAAAGGGGAGAAGTC -3'

Sequencing Primer
(F):5'- ACTGTGGCAGAGCTAATCATCTTG -3'
(R):5'- TGCTACATAGCGATCATAGGC -3'
Posted On2014-05-23