Incidental Mutation 'R1746:Ednra'
ID193985
Institutional Source Beutler Lab
Gene Symbol Ednra
Ensembl Gene ENSMUSG00000031616
Gene Nameendothelin receptor type A
SynonymsGpcr10, ET-AR, ETa
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location77663031-77724464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 77671582 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 279 (T279P)
Ref Sequence ENSEMBL: ENSMUSP00000034029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034029]
Predicted Effect probably benign
Transcript: ENSMUST00000034029
AA Change: T279P

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034029
Gene: ENSMUSG00000031616
AA Change: T279P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:7tm_1 97 370 8.4e-36 PFAM
low complexity region 376 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153937
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this gene results in numerous severe craniofacial defects and perinatal lethality. Aberrant middle ear development and cardiac defects, including great vessel malformations and abnormal cardiac outflow tract development, have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Ednra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ednra APN 8 77675071 missense probably damaging 1.00
IGL02943:Ednra APN 8 77720054 missense probably damaging 1.00
IGL03213:Ednra APN 8 77720219 missense probably benign
Starved UTSW 8 77675067 missense possibly damaging 0.82
R0058:Ednra UTSW 8 77667322 critical splice donor site probably null
R0080:Ednra UTSW 8 77675059 missense probably benign
R0894:Ednra UTSW 8 77720020 splice site probably benign
R1872:Ednra UTSW 8 77720396 missense possibly damaging 0.46
R1934:Ednra UTSW 8 77689118 missense possibly damaging 0.55
R3776:Ednra UTSW 8 77675095 missense probably damaging 1.00
R4177:Ednra UTSW 8 77675048 missense possibly damaging 0.54
R4274:Ednra UTSW 8 77720302 missense probably benign 0.01
R4544:Ednra UTSW 8 77674911 critical splice donor site probably null
R4697:Ednra UTSW 8 77664995 missense probably benign 0.01
R4704:Ednra UTSW 8 77667963 intron probably benign
R4863:Ednra UTSW 8 77667383 missense probably damaging 1.00
R5265:Ednra UTSW 8 77667375 missense probably damaging 1.00
R5346:Ednra UTSW 8 77674968 missense probably damaging 1.00
R5772:Ednra UTSW 8 77675067 missense possibly damaging 0.82
R6005:Ednra UTSW 8 77674927 missense possibly damaging 0.91
R6147:Ednra UTSW 8 77667322 critical splice donor site probably benign
R6384:Ednra UTSW 8 77689094 missense probably damaging 1.00
R6743:Ednra UTSW 8 77675089 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGCATACTGGAGGCAAGTGTATC -3'
(R):5'- TCAGCAGCATGTGTGAAGCACC -3'

Sequencing Primer
(F):5'- CTGGAGGCAAGTGTATCTCGTTAG -3'
(R):5'- TATAAACTGTATCCACAAGCACGGAG -3'
Posted On2014-05-23