Incidental Mutation 'R1746:Cntn5'
ID193990
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9831572 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 601 (D601V)
Ref Sequence ENSEMBL: ENSMUSP00000124327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect probably damaging
Transcript: ENSMUST00000074133
AA Change: D601V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: D601V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160216
AA Change: D601V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: D601V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162484
AA Change: D396V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: D396V

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179049
AA Change: D396V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: D396V

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9781769 missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3056:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4164:Cntn5 UTSW 9 9781676 missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10048771 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAAGGAGCAATTGATGAGCTTCCAG -3'
(R):5'- CTGCCAAAAGAACGAAACCCTATTTGAG -3'

Sequencing Primer
(F):5'- aaacaaacaaacaagcaaacaaac -3'
(R):5'- GAACGAAACCCTATTTGAGTTTGATG -3'
Posted On2014-05-23