Incidental Mutation 'R1746:Rundc3a'
ID193999
Institutional Source Beutler Lab
Gene Symbol Rundc3a
Ensembl Gene ENSMUSG00000006575
Gene NameRUN domain containing 3A
SynonymsRpip8, Rap2ip
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R1746 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location102393403-102402555 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GAGCC to GAGCCAGCC at 102400913 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006750] [ENSMUST00000018821] [ENSMUST00000107098] [ENSMUST00000107102] [ENSMUST00000107103] [ENSMUST00000107105] [ENSMUST00000124755] [ENSMUST00000130436] [ENSMUST00000134669] [ENSMUST00000142097] [ENSMUST00000149777] [ENSMUST00000154001] [ENSMUST00000155104]
Predicted Effect probably null
Transcript: ENSMUST00000006750
SMART Domains Protein: ENSMUSP00000006750
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018821
SMART Domains Protein: ENSMUSP00000018821
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 156 6.9e-23 PFAM
Pfam:Mito_carr 158 247 6.1e-19 PFAM
Pfam:Mito_carr 251 352 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107098
SMART Domains Protein: ENSMUSP00000102715
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 148 1.4e-21 PFAM
Pfam:Mito_carr 150 240 3.7e-19 PFAM
Pfam:Mito_carr 243 344 4.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107102
SMART Domains Protein: ENSMUSP00000102719
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 322 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107103
SMART Domains Protein: ENSMUSP00000102720
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 120 182 2.34e-19 SMART
coiled coil region 262 317 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107105
SMART Domains Protein: ENSMUSP00000102722
Gene: ENSMUSG00000006575

DomainStartEndE-ValueType
RUN 125 187 2.34e-19 SMART
coiled coil region 267 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123688
Predicted Effect probably benign
Transcript: ENSMUST00000124755
SMART Domains Protein: ENSMUSP00000120021
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 71 1.3e-9 PFAM
Pfam:Mito_carr 92 152 9.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128331
Predicted Effect probably benign
Transcript: ENSMUST00000128825
SMART Domains Protein: ENSMUSP00000121790
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 35 77 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130436
SMART Domains Protein: ENSMUSP00000115087
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 1.8e-9 PFAM
Pfam:Mito_carr 92 156 5.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132876
Predicted Effect probably benign
Transcript: ENSMUST00000134669
SMART Domains Protein: ENSMUSP00000114481
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141535
Predicted Effect probably benign
Transcript: ENSMUST00000142097
SMART Domains Protein: ENSMUSP00000114365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 63 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147860
Predicted Effect probably benign
Transcript: ENSMUST00000149777
SMART Domains Protein: ENSMUSP00000115365
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 2.7e-9 PFAM
Pfam:Mito_carr 92 156 8.7e-15 PFAM
Pfam:Mito_carr 158 220 6.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153395
Predicted Effect probably benign
Transcript: ENSMUST00000154001
SMART Domains Protein: ENSMUSP00000116336
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 70 3.1e-10 PFAM
Pfam:Mito_carr 92 156 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155104
SMART Domains Protein: ENSMUSP00000115445
Gene: ENSMUSG00000018677

DomainStartEndE-ValueType
Pfam:Mito_carr 7 69 3.7e-9 PFAM
Pfam:Mito_carr 92 156 1.2e-14 PFAM
Pfam:Mito_carr 158 248 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183859
Meta Mutation Damage Score 0.6356 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Rundc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Rundc3a APN 11 102393776 missense probably benign 0.43
IGL02206:Rundc3a APN 11 102399634 nonsense probably null
IGL02306:Rundc3a APN 11 102400938 missense probably damaging 1.00
IGL02838:Rundc3a APN 11 102397695 splice site probably benign
R0173:Rundc3a UTSW 11 102398245 unclassified probably benign
R1745:Rundc3a UTSW 11 102400913 frame shift probably null
R2208:Rundc3a UTSW 11 102402088 missense probably damaging 1.00
R2366:Rundc3a UTSW 11 102397665 missense probably damaging 1.00
R2994:Rundc3a UTSW 11 102400663 missense probably damaging 1.00
R3755:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R3756:Rundc3a UTSW 11 102399259 missense possibly damaging 0.48
R5519:Rundc3a UTSW 11 102402031 missense probably benign 0.01
R5748:Rundc3a UTSW 11 102399399 missense possibly damaging 0.63
R6361:Rundc3a UTSW 11 102400795 missense probably damaging 1.00
R6722:Rundc3a UTSW 11 102399949 missense possibly damaging 0.73
R6819:Rundc3a UTSW 11 102398461 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCACTCAAGTTTCCGTCCTAAGCC -3'
(R):5'- ATGACACTAGAAAGCCGTTGCGCC -3'

Sequencing Primer
(F):5'- TAGTCAACCAGTGGCCCTC -3'
(R):5'- acaggtagaagaggtgggg -3'
Posted On2014-05-23