Incidental Mutation 'R1746:Skp2'
ID194010
Institutional Source Beutler Lab
Gene Symbol Skp2
Ensembl Gene ENSMUSG00000054115
Gene NameS-phase kinase-associated protein 2 (p45)
SynonymsFBXL1
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9111985-9155425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9139443 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 55 (E55G)
Ref Sequence ENSEMBL: ENSMUSP00000139997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090380] [ENSMUST00000096482] [ENSMUST00000110585] [ENSMUST00000190131] [ENSMUST00000227556]
Predicted Effect probably benign
Transcript: ENSMUST00000090380
SMART Domains Protein: ENSMUSP00000087858
Gene: ENSMUSG00000039704

DomainStartEndE-ValueType
Pfam:LMBR1 8 546 4.2e-192 PFAM
low complexity region 574 598 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096482
AA Change: E90G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094225
Gene: ENSMUSG00000054115
AA Change: E90G

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
LRR 205 229 1.27e2 SMART
LRR 230 254 1.28e1 SMART
LRR 255 280 2.91e1 SMART
LRR 334 359 2.83e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110585
AA Change: E90G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106215
Gene: ENSMUSG00000054115
AA Change: E90G

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
Blast:LRR 205 229 5e-7 BLAST
Blast:LRR 229 253 3e-7 BLAST
Blast:LRR 255 284 3e-10 BLAST
Blast:LRR 309 334 3e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000190131
AA Change: E55G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115
AA Change: E55G

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191316
Predicted Effect probably benign
Transcript: ENSMUST00000227556
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, enlarged cell and nuclear sizes, polyploidy, reduced cell growth rate, overduplication of centrosomes, increased apoptosis rate, delayed wound healing, and aberrant immunoglobulin V(D)J recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrg2 G A 18: 36,021,922 T503M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Skp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Skp2 APN 15 9139487 missense probably benign 0.00
IGL02135:Skp2 APN 15 9125147 missense probably benign
R0050:Skp2 UTSW 15 9125091 missense probably benign 0.03
R0129:Skp2 UTSW 15 9125193 missense probably damaging 1.00
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1503:Skp2 UTSW 15 9127911 missense probably damaging 1.00
R1660:Skp2 UTSW 15 9125114 missense probably benign 0.03
R2031:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2034:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2087:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2088:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2090:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2091:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R4272:Skp2 UTSW 15 9116860 critical splice donor site probably null
R4428:Skp2 UTSW 15 9116947 missense probably benign 0.21
R4747:Skp2 UTSW 15 9113839 missense possibly damaging 0.93
R5734:Skp2 UTSW 15 9139479 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTCACTGCCACACTTCCAAACTAGG -3'
(R):5'- AGGAAGCACCTTCAGGAGATTCCG -3'

Sequencing Primer
(F):5'- TCCAAACTAGGCAATTTTAGGCAC -3'
(R):5'- AGACTTCTGAACTGCTATCAGGC -3'
Posted On2014-05-23