Incidental Mutation 'R1746:Nrg2'
ID194017
Institutional Source Beutler Lab
Gene Symbol Nrg2
Ensembl Gene ENSMUSG00000060275
Gene Nameneuregulin 2
SynonymsNTAK, Don1
MMRRC Submission 039778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1746 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36017707-36197380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36021922 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 503 (T503M)
Ref Sequence ENSEMBL: ENSMUSP00000111378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115713]
Predicted Effect probably damaging
Transcript: ENSMUST00000115712
AA Change: T317M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275
AA Change: T317M

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 1.66e-2 SMART
Pfam:Neuregulin 403 834 1.7e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115713
AA Change: T503M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: T503M

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 3.76e-1 SMART
Pfam:Neuregulin 409 844 4.4e-170 PFAM
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 T A 13: 70,779,598 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aknad1 A G 3: 108,751,783 T38A possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap21 T C 2: 20,861,099 E902G probably damaging Het
Atg2b A G 12: 105,669,329 S227P possibly damaging Het
Atp2c2 C T 8: 119,734,443 probably benign Het
Atxn10 T C 15: 85,376,663 V203A probably damaging Het
Chd9 A C 8: 91,010,698 E1468D probably benign Het
Cntn5 T A 9: 9,831,572 D601V probably damaging Het
Col4a2 G A 8: 11,446,020 G1547D probably benign Het
Cul1 A G 6: 47,508,245 E270G probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dmgdh C A 13: 93,752,425 T857K probably benign Het
Ednra T G 8: 77,671,582 T279P probably benign Het
Erbin A G 13: 103,850,831 I407T probably damaging Het
Fggy A G 4: 95,926,728 Y440C probably damaging Het
Flrt2 A T 12: 95,780,792 N635Y possibly damaging Het
Fnbp1l A G 3: 122,556,491 I357T probably benign Het
Gulp1 A G 1: 44,754,353 H58R possibly damaging Het
Hid1 A T 11: 115,354,638 V446E probably damaging Het
Igfn1 A G 1: 135,969,823 S1002P possibly damaging Het
Klri1 A G 6: 129,698,155 probably null Het
Kmt2d A C 15: 98,864,378 L409R probably damaging Het
Ltn1 A C 16: 87,411,781 S810A possibly damaging Het
Mysm1 G A 4: 94,948,411 Q721* probably null Het
Nae1 A G 8: 104,527,385 V105A possibly damaging Het
Nagpa C T 16: 5,203,639 V83M probably damaging Het
Nrxn3 A G 12: 89,255,019 M150V possibly damaging Het
Olfr472 C A 7: 107,902,886 H56Q probably benign Het
Olfr945 A G 9: 39,258,202 S157P probably damaging Het
Papola T A 12: 105,807,209 D162E probably benign Het
Plxnc1 T C 10: 94,844,179 probably null Het
Ppp1r16b T A 2: 158,746,665 probably null Het
Ptprq T A 10: 107,638,830 E1338V probably damaging Het
Puf60 G A 15: 76,070,784 H437Y probably benign Het
Qsox2 C T 2: 26,220,638 V189I probably benign Het
Rad51ap2 A T 12: 11,457,775 D566V probably benign Het
Rb1cc1 T A 1: 6,263,013 probably null Het
Rfpl4b C T 10: 38,821,053 C184Y possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rundc3a GAGCC GAGCCAGCC 11: 102,400,913 probably null Het
Scara5 A C 14: 65,731,090 M271L probably benign Het
Sel1l2 A G 2: 140,285,237 L118P probably damaging Het
Sema6a T A 18: 47,306,349 probably benign Het
Siglech T A 7: 55,768,504 H73Q probably benign Het
Sim1 A G 10: 50,984,109 D689G probably benign Het
Skp2 T C 15: 9,139,443 E55G possibly damaging Het
Slc1a1 T A 19: 28,894,469 V114E probably benign Het
Slc26a6 G A 9: 108,861,717 G614D probably benign Het
Sptbn2 C T 19: 4,745,964 Q1724* probably null Het
Tet3 T C 6: 83,368,068 T1796A probably damaging Het
Tmem117 A C 15: 94,931,833 D183A possibly damaging Het
Trmt44 A G 5: 35,564,059 S587P probably benign Het
Ttn G T 2: 76,788,822 probably benign Het
Tubgcp5 G A 7: 55,808,537 V399M probably benign Het
Txndc2 T A 17: 65,638,135 D349V probably damaging Het
Uggt2 T A 14: 119,013,503 N1194I probably benign Het
Vmn1r178 A T 7: 23,893,904 I53L probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Other mutations in Nrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nrg2 APN 18 36021218 missense probably benign 0.00
IGL01396:Nrg2 APN 18 36045852 splice site probably benign
R0179:Nrg2 UTSW 18 36022415 missense probably benign 0.13
R0976:Nrg2 UTSW 18 36021091 missense probably benign 0.21
R1387:Nrg2 UTSW 18 36196739 missense probably damaging 1.00
R1487:Nrg2 UTSW 18 36052912 missense possibly damaging 0.69
R1882:Nrg2 UTSW 18 36021097 missense probably damaging 1.00
R1940:Nrg2 UTSW 18 36196844 unclassified probably benign
R2090:Nrg2 UTSW 18 36018443 missense probably benign 0.00
R2183:Nrg2 UTSW 18 36196751 missense probably benign 0.11
R4664:Nrg2 UTSW 18 36052895 missense possibly damaging 0.87
R4677:Nrg2 UTSW 18 36021099 missense possibly damaging 0.92
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R5091:Nrg2 UTSW 18 36052785 missense probably damaging 1.00
R6657:Nrg2 UTSW 18 36196589 missense probably damaging 0.98
R6968:Nrg2 UTSW 18 36196446 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCTTGCATGGACAGGTTGCC -3'
(R):5'- TCACGCTGCCCATTTCCATAAGG -3'

Sequencing Primer
(F):5'- TTGCCCCAGTCCTGGAGAG -3'
(R):5'- GAGCTATCTGTGACCCACTG -3'
Posted On2014-05-23