Incidental Mutation 'R1747:Prdm14'
ID194022
Institutional Source Beutler Lab
Gene Symbol Prdm14
Ensembl Gene ENSMUSG00000042414
Gene NamePR domain containing 14
Synonyms
MMRRC Submission 039779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1747 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location13113457-13127163 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13122403 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 371 (V371I)
Ref Sequence ENSEMBL: ENSMUSP00000044245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047577
AA Change: V371I

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044245
Gene: ENSMUSG00000042414
AA Change: V371I

DomainStartEndE-ValueType
low complexity region 120 139 N/A INTRINSIC
SET 244 362 2.8e-11 SMART
low complexity region 373 389 N/A INTRINSIC
ZnF_C2H2 390 410 1.4e-1 SMART
ZnF_C2H2 422 445 5.3e-5 SMART
ZnF_C2H2 451 473 3.2e-7 SMART
ZnF_C2H2 479 501 1.4e-4 SMART
ZnF_C2H2 507 530 8.1e-5 SMART
ZnF_C2H2 536 558 4.6e-4 SMART
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PRDI-BF1 and RIZ homology domain containing (PRDM) family of transcriptional regulators. The encoded protein may possess histone methyltransferase activity and plays a critical role in cell pluripotency by suppressing the expression of differentiation marker genes. Expression of this gene may play a role in breast cancer. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased primordial germ cell numbers, absent germ cells, and sterility in both males and females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik C T 8: 13,558,814 S117N probably damaging Het
A830010M20Rik T C 5: 107,451,999 S119P probably damaging Het
Acat3 A G 17: 12,924,808 I349T possibly damaging Het
Add3 A G 19: 53,242,550 N552S probably benign Het
Ak3 G T 19: 29,022,861 P217T possibly damaging Het
Aox2 A T 1: 58,339,592 D1000V probably benign Het
Ap1m2 A G 9: 21,305,686 M118T probably damaging Het
Arhgap28 C A 17: 67,901,309 A105S probably benign Het
Arhgef28 T C 13: 97,936,824 E1368G probably damaging Het
Armc7 G A 11: 115,488,757 V94I probably benign Het
Asxl1 C A 2: 153,393,454 T223N possibly damaging Het
Cltc T C 11: 86,707,081 K1078E probably damaging Het
Cpne8 G A 15: 90,584,915 T158I probably benign Het
Csn1s2b T C 5: 87,816,670 probably benign Het
Cyp3a59 A G 5: 146,104,758 I371V probably benign Het
Dennd4c T C 4: 86,807,438 F710L probably damaging Het
Diaph3 T C 14: 87,073,337 D126G probably damaging Het
Dnm3 G A 1: 162,313,584 R369C probably damaging Het
Dst A C 1: 34,160,709 Q86P probably damaging Het
Ern2 C A 7: 122,173,819 probably null Het
Ern2 T A 7: 122,173,820 probably null Het
Exoc6 T A 19: 37,639,769 probably null Het
Glg1 G A 8: 111,197,673 R228C probably damaging Het
Gm4736 G A 6: 132,115,670 noncoding transcript Het
Hmcn2 G C 2: 31,457,985 G4881A probably benign Het
Htr2a T G 14: 74,706,153 F391C probably damaging Het
Htr5b A T 1: 121,527,918 V91E probably damaging Het
Ifi44 T A 3: 151,749,285 H101L probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl6 T A 16: 19,947,028 H608L probably benign Het
Lrp4 T C 2: 91,492,621 V1150A probably damaging Het
Lyst T C 13: 13,757,422 F3545S probably benign Het
Magi3 T C 3: 104,034,173 D822G possibly damaging Het
Nbas G A 12: 13,335,898 S721N probably benign Het
Nog T A 11: 89,301,582 M147L probably benign Het
Npr1 C T 3: 90,458,669 C605Y possibly damaging Het
Olfr1053 G A 2: 86,314,867 L140F probably benign Het
Olfr866 A C 9: 20,027,317 V207G probably benign Het
Pgs1 A G 11: 118,001,631 S10G probably benign Het
Pla2g4c T C 7: 13,337,730 probably benign Het
Prom1 C T 5: 44,007,031 V703I probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Scnn1g A T 7: 121,760,463 I390F probably damaging Het
Scrt2 C T 2: 152,093,718 H264Y probably damaging Het
Sel1l3 C T 5: 53,145,545 E661K possibly damaging Het
Skiv2l G T 17: 34,847,806 P162H probably benign Het
Slc10a5 G T 3: 10,335,391 Q70K probably benign Het
Smg8 A G 11: 87,085,303 V484A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stag1 T A 9: 100,888,300 S630T probably benign Het
Thyn1 A C 9: 27,005,213 Q98P probably damaging Het
Ttc7 A G 17: 87,307,015 R203G possibly damaging Het
Ttn T C 2: 76,878,516 probably benign Het
Vmn1r236 C T 17: 21,286,917 S99L probably benign Het
Vmn2r50 T A 7: 10,047,678 H380L probably benign Het
Vmn2r73 A T 7: 85,858,167 C646S probably damaging Het
Wnt10b A G 15: 98,774,333 S168P probably benign Het
Zc3h7a A G 16: 11,145,253 M748T possibly damaging Het
Zfp804b C G 5: 6,770,217 E913Q probably benign Het
Zfp974 G T 7: 27,911,081 F406L possibly damaging Het
Zic4 G A 9: 91,384,146 C274Y probably damaging Het
Other mutations in Prdm14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Prdm14 APN 1 13125439 missense probably benign 0.07
R0099:Prdm14 UTSW 1 13118945 missense probably damaging 0.96
R0243:Prdm14 UTSW 1 13122448 missense probably damaging 1.00
R0312:Prdm14 UTSW 1 13118807 missense probably damaging 1.00
R0576:Prdm14 UTSW 1 13125725 missense possibly damaging 0.87
R0781:Prdm14 UTSW 1 13114361 missense probably damaging 0.99
R0791:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0792:Prdm14 UTSW 1 13125744 missense probably benign 0.30
R0855:Prdm14 UTSW 1 13125537 missense probably benign 0.00
R0905:Prdm14 UTSW 1 13125438 missense probably benign 0.00
R1467:Prdm14 UTSW 1 13124532 splice site probably benign
R1771:Prdm14 UTSW 1 13118858 missense probably damaging 1.00
R2073:Prdm14 UTSW 1 13125730 missense possibly damaging 0.95
R2170:Prdm14 UTSW 1 13122460 missense probably damaging 1.00
R2432:Prdm14 UTSW 1 13125633 missense probably benign
R4948:Prdm14 UTSW 1 13122631 missense probably damaging 1.00
R6267:Prdm14 UTSW 1 13118936 missense probably damaging 1.00
R6902:Prdm14 UTSW 1 13122421 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAGTGGATCAAACTCACTAGCCC -3'
(R):5'- ATGTCAACTGTGCTCGGTTCCC -3'

Sequencing Primer
(F):5'- GATCAAACTCACTAGCCCACAATATG -3'
(R):5'- GGTTCCCCAAGGAGCAG -3'
Posted On2014-05-23