Incidental Mutation 'R1747:Zfp804b'
ID194038
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission 039779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R1747 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 6770217 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 913 (E913Q)
Ref Sequence ENSEMBL: ENSMUSP00000130571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably benign
Transcript: ENSMUST00000164784
AA Change: E913Q

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: E913Q

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200317
AA Change: E949Q

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: E949Q

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik C T 8: 13,558,814 S117N probably damaging Het
A830010M20Rik T C 5: 107,451,999 S119P probably damaging Het
Acat3 A G 17: 12,924,808 I349T possibly damaging Het
Add3 A G 19: 53,242,550 N552S probably benign Het
Ak3 G T 19: 29,022,861 P217T possibly damaging Het
Aox2 A T 1: 58,339,592 D1000V probably benign Het
Ap1m2 A G 9: 21,305,686 M118T probably damaging Het
Arhgap28 C A 17: 67,901,309 A105S probably benign Het
Arhgef28 T C 13: 97,936,824 E1368G probably damaging Het
Armc7 G A 11: 115,488,757 V94I probably benign Het
Asxl1 C A 2: 153,393,454 T223N possibly damaging Het
Cltc T C 11: 86,707,081 K1078E probably damaging Het
Cpne8 G A 15: 90,584,915 T158I probably benign Het
Csn1s2b T C 5: 87,816,670 probably benign Het
Cyp3a59 A G 5: 146,104,758 I371V probably benign Het
Dennd4c T C 4: 86,807,438 F710L probably damaging Het
Diaph3 T C 14: 87,073,337 D126G probably damaging Het
Dnm3 G A 1: 162,313,584 R369C probably damaging Het
Dst A C 1: 34,160,709 Q86P probably damaging Het
Ern2 C A 7: 122,173,819 probably null Het
Ern2 T A 7: 122,173,820 probably null Het
Exoc6 T A 19: 37,639,769 probably null Het
Glg1 G A 8: 111,197,673 R228C probably damaging Het
Gm4736 G A 6: 132,115,670 noncoding transcript Het
Hmcn2 G C 2: 31,457,985 G4881A probably benign Het
Htr2a T G 14: 74,706,153 F391C probably damaging Het
Htr5b A T 1: 121,527,918 V91E probably damaging Het
Ifi44 T A 3: 151,749,285 H101L probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl6 T A 16: 19,947,028 H608L probably benign Het
Lrp4 T C 2: 91,492,621 V1150A probably damaging Het
Lyst T C 13: 13,757,422 F3545S probably benign Het
Magi3 T C 3: 104,034,173 D822G possibly damaging Het
Nbas G A 12: 13,335,898 S721N probably benign Het
Nog T A 11: 89,301,582 M147L probably benign Het
Npr1 C T 3: 90,458,669 C605Y possibly damaging Het
Olfr1053 G A 2: 86,314,867 L140F probably benign Het
Olfr866 A C 9: 20,027,317 V207G probably benign Het
Pgs1 A G 11: 118,001,631 S10G probably benign Het
Pla2g4c T C 7: 13,337,730 probably benign Het
Prdm14 C T 1: 13,122,403 V371I possibly damaging Het
Prom1 C T 5: 44,007,031 V703I probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Scnn1g A T 7: 121,760,463 I390F probably damaging Het
Scrt2 C T 2: 152,093,718 H264Y probably damaging Het
Sel1l3 C T 5: 53,145,545 E661K possibly damaging Het
Skiv2l G T 17: 34,847,806 P162H probably benign Het
Slc10a5 G T 3: 10,335,391 Q70K probably benign Het
Smg8 A G 11: 87,085,303 V484A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stag1 T A 9: 100,888,300 S630T probably benign Het
Thyn1 A C 9: 27,005,213 Q98P probably damaging Het
Ttc7 A G 17: 87,307,015 R203G possibly damaging Het
Ttn T C 2: 76,878,516 probably benign Het
Vmn1r236 C T 17: 21,286,917 S99L probably benign Het
Vmn2r50 T A 7: 10,047,678 H380L probably benign Het
Vmn2r73 A T 7: 85,858,167 C646S probably damaging Het
Wnt10b A G 15: 98,774,333 S168P probably benign Het
Zc3h7a A G 16: 11,145,253 M748T possibly damaging Het
Zfp974 G T 7: 27,911,081 F406L possibly damaging Het
Zic4 G A 9: 91,384,146 C274Y probably damaging Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense not run
R7099:Zfp804b UTSW 5 6772161 missense not run
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCTCTGTGGAATCAGTTACGCC -3'
(R):5'- CACTGCCAACTACCTTCTAAGGAGC -3'

Sequencing Primer
(F):5'- GTGGAATCAGTTACGCCAGTATATC -3'
(R):5'- CTGTAGAGGTGGCCCTTCAG -3'
Posted On2014-05-23